Check in the pristine copy of ICU 4.6...

icu46/source/test/intltest/ssearch.cpp

+/*
+ **********************************************************************
+ *   Copyright (C) 2005-2010, International Business Machines
+ *   Corporation and others.  All Rights Reserved.
+ **********************************************************************
+ */
+
+
+#include "unicode/utypes.h"
+
+#if !UCONFIG_NO_COLLATION
+
+#include "unicode/unistr.h"
+#include "unicode/putil.h"
+#include "unicode/usearch.h"
+
+#include "cmemory.h"
+#include "unicode/coll.h"
+#include "unicode/tblcoll.h"
+#include "unicode/coleitr.h"
+#include "unicode/ucoleitr.h"
+
+#include "unicode/regex.h"        // TODO: make conditional on regexp being built.
+
+#include "unicode/uniset.h"
+#include "unicode/uset.h"
+#include "unicode/ustring.h"
+#include "hash.h"
+#include "uhash.h"
+#include "ucol_imp.h"
+
+#include "intltest.h"
+#include "ssearch.h"
+
+#include "unicode/colldata.h"
+#include "unicode/bmsearch.h"
+#include "unicode/bms.h"
+
+#include "xmlparser.h"
+#include "ucbuf.h"
+
+#include <stdlib.h>
+#include <string.h>
+#include <stdio.h>
+
+char testId[100];
+
+#define TEST_ASSERT(x) {if (!(x)) { \
+    errln("Failure in file %s, line %d, test ID = \"%s\"", __FILE__, __LINE__, testId);}}
+
+#define TEST_ASSERT_M(x, m) {if (!(x)) { \
+    errln("Failure in file %s, line %d.   \"%s\"", __FILE__, __LINE__, m);return;}}
+
+#define TEST_ASSERT_SUCCESS(errcode) {if (U_FAILURE(errcode)) { \
+    dataerrln("Failure in file %s, line %d, test ID \"%s\", status = \"%s\"", \
+          __FILE__, __LINE__, testId, u_errorName(errcode));}}
+
+#define ARRAY_SIZE(array) (sizeof array / sizeof array[0])
+#define NEW_ARRAY(type, count) (type *) uprv_malloc((count) * sizeof(type))
+#define DELETE_ARRAY(array) uprv_free((void *) (array))
+
+//---------------------------------------------------------------------------
+//
+//  Test class boilerplate
+//
+//---------------------------------------------------------------------------
+SSearchTest::SSearchTest()
+{
+}
+
+SSearchTest::~SSearchTest()
+{
+}
+
+void SSearchTest::runIndexedTest( int32_t index, UBool exec, const char* &name, char *params )
+{
+    if (exec) logln("TestSuite SSearchTest: ");
+    switch (index) {
+#if !UCONFIG_NO_BREAK_ITERATION
+       case 0: name = "searchTest";
+            if (exec) searchTest();
+            break;
+
+        case 1: name = "offsetTest";
+            if (exec) offsetTest();
+            break;
+
+        case 2: name = "monkeyTest";
+            if (exec) monkeyTest(params);
+            break;
+
+        case 3: name = "bmMonkeyTest";
+            if (exec) bmMonkeyTest(params);
+            break;
+
+        case 4: name = "boyerMooreTest";
+            if (exec) boyerMooreTest();
+            break;
+
+        case 5: name = "goodSuffixTest";
+            if (exec) goodSuffixTest();
+            break;
+
+        case 6: name = "searchTime";
+            if (exec) searchTime();
+            break;
+
+        case 7: name = "bmsTest";
+            if (exec) bmsTest();
+            break;
+
+        case 8: name = "bmSearchTest";
+            if (exec) bmSearchTest();
+            break;
+
+        case 9: name = "udhrTest";
+            if (exec) udhrTest();
+            break;
+        case 10: name = "stringListTest";
+            if (exec) stringListTest();
+            break;
+#endif
+        default: name = "";
+            break; //needed to end loop
+    }
+}
+
+
+#if !UCONFIG_NO_BREAK_ITERATION
+
+#define PATH_BUFFER_SIZE 2048
+const char *SSearchTest::getPath(char buffer[2048], const char *filename) {
+    UErrorCode status = U_ZERO_ERROR;
+    const char *testDataDirectory = IntlTest::getSourceTestData(status);
+
+    if (U_FAILURE(status) || strlen(testDataDirectory) + strlen(filename) + 1 >= PATH_BUFFER_SIZE) {
+        errln("ERROR: getPath() failed - %s", u_errorName(status));
+        return NULL;
+    }
+
+    strcpy(buffer, testDataDirectory);
+    strcat(buffer, filename);
+    return buffer;
+}
+
+
+void SSearchTest::searchTest()
+{
+#if !UCONFIG_NO_REGULAR_EXPRESSIONS && !UCONFIG_NO_FILE_IO
+    UErrorCode status = U_ZERO_ERROR;
+    char path[PATH_BUFFER_SIZE];
+    const char *testFilePath = getPath(path, "ssearch.xml");
+
+    if (testFilePath == NULL) {
+        return; /* Couldn't get path: error message already output. */
+    }
+
+    LocalPointer<UXMLParser> parser(UXMLParser::createParser(status));
+    TEST_ASSERT_SUCCESS(status);
+    LocalPointer<UXMLElement> root(parser->parseFile(testFilePath, status));
+    TEST_ASSERT_SUCCESS(status);
+    if (U_FAILURE(status)) {
+        return;
+    }
+
+    const UnicodeString *debugTestCase = root->getAttribute("debug");
+    if (debugTestCase != NULL) {
+//       setenv("USEARCH_DEBUG", "1", 1);
+    }
+
+
+    const UXMLElement *testCase;
+    int32_t tc = 0;
+
+    while((testCase = root->nextChildElement(tc)) != NULL) {
+
+        if (testCase->getTagName().compare("test-case") != 0) {
+            errln("ssearch, unrecognized XML Element in test file");
+            continue;
+        }
+        const UnicodeString *id       = testCase->getAttribute("id");
+        *testId = 0;
+        if (id != NULL) {
+            id->extract(0, id->length(), testId,  sizeof(testId), US_INV);
+        }
+
+        // If debugging test case has been specified and this is not it, skip to next.
+        if (id!=NULL && debugTestCase!=NULL && *id != *debugTestCase) {
+            continue;
+        }
+        //
+        //  Get the requested collation strength.
+        //    Default is tertiary if the XML attribute is missing from the test case.
+        //
+        const UnicodeString *strength = testCase->getAttribute("strength");
+        UColAttributeValue collatorStrength = UCOL_PRIMARY;
+        if      (strength==NULL)          { collatorStrength = UCOL_TERTIARY;}
+        else if (*strength=="PRIMARY")    { collatorStrength = UCOL_PRIMARY;}
+        else if (*strength=="SECONDARY")  { collatorStrength = UCOL_SECONDARY;}
+        else if (*strength=="TERTIARY")   { collatorStrength = UCOL_TERTIARY;}
+        else if (*strength=="QUATERNARY") { collatorStrength = UCOL_QUATERNARY;}
+        else if (*strength=="IDENTICAL")  { collatorStrength = UCOL_IDENTICAL;}
+        else {
+            // Bogus value supplied for strength.  Shouldn't happen, even from
+            //  typos, if the  XML source has been validated.
+            //  This assert is a little deceiving in that strength can be
+            //   any of the allowed values, not just TERTIARY, but it will
+            //   do the job of getting the error output.
+            TEST_ASSERT(*strength=="TERTIARY")
+        }
+
+        //
+        // Get the collator normalization flag.  Default is UCOL_OFF.
+        //
+        UColAttributeValue normalize = UCOL_OFF;
+        const UnicodeString *norm = testCase->getAttribute("norm");
+        TEST_ASSERT (norm==NULL || *norm=="ON" || *norm=="OFF");
+        if (norm!=NULL && *norm=="ON") {
+            normalize = UCOL_ON;
+        }
+
+        //
+        // Get the alternate_handling flag. Default is UCOL_NON_IGNORABLE.
+        //
+        UColAttributeValue alternateHandling = UCOL_NON_IGNORABLE;
+        const UnicodeString *alt = testCase->getAttribute("alternate_handling");
+        TEST_ASSERT (alt == NULL || *alt == "SHIFTED" || *alt == "NON_IGNORABLE");
+        if (alt != NULL && *alt == "SHIFTED") {
+            alternateHandling = UCOL_SHIFTED;
+        }
+
+        const UnicodeString defLocale("en");
+        char  clocale[100];
+        const UnicodeString *locale   = testCase->getAttribute("locale");
+        if (locale == NULL || locale->length()==0) {
+            locale = &defLocale;
+        };
+        locale->extract(0, locale->length(), clocale, sizeof(clocale), NULL);
+
+
+        UnicodeString  text;
+        UnicodeString  target;
+        UnicodeString  pattern;
+        int32_t        expectedMatchStart = -1;
+        int32_t        expectedMatchLimit = -1;
+        const UXMLElement  *n;
+        int32_t                nodeCount = 0;
+
+        n = testCase->getChildElement("pattern");
+        TEST_ASSERT(n != NULL);
+        if (n==NULL) {
+            continue;
+        }
+        text = n->getText(FALSE);
+        text = text.unescape();
+        pattern.append(text);
+        nodeCount++;
+
+        n = testCase->getChildElement("pre");
+        if (n!=NULL) {
+            text = n->getText(FALSE);
+            text = text.unescape();
+            target.append(text);
+            nodeCount++;
+        }
+
+        n = testCase->getChildElement("m");
+        if (n!=NULL) {
+            expectedMatchStart = target.length();
+            text = n->getText(FALSE);
+            text = text.unescape();
+            target.append(text);
+            expectedMatchLimit = target.length();
+            nodeCount++;
+        }
+
+        n = testCase->getChildElement("post");
+        if (n!=NULL) {
+            text = n->getText(FALSE);
+            text = text.unescape();
+            target.append(text);
+            nodeCount++;
+        }
+
+        //  Check that there weren't extra things in the XML
+        TEST_ASSERT(nodeCount == testCase->countChildren());
+
+        // Open a collator and StringSearch based on the parameters
+        //   obtained from the XML.
+        //
+        status = U_ZERO_ERROR;
+        LocalUCollatorPointer collator(ucol_open(clocale, &status));
+        ucol_setStrength(collator.getAlias(), collatorStrength);
+        ucol_setAttribute(collator.getAlias(), UCOL_NORMALIZATION_MODE, normalize, &status);
+        ucol_setAttribute(collator.getAlias(), UCOL_ALTERNATE_HANDLING, alternateHandling, &status);
+        LocalUStringSearchPointer uss(usearch_openFromCollator(pattern.getBuffer(), pattern.length(),
+                                                               target.getBuffer(), target.length(),
+                                                               collator.getAlias(),
+                                                               NULL,     // the break iterator
+                                                               &status));
+
+        TEST_ASSERT_SUCCESS(status);
+        if (U_FAILURE(status)) {
+            continue;
+        }
+
+        int32_t foundStart = 0;
+        int32_t foundLimit = 0;
+        UBool   foundMatch;
+
+        //
+        // Do the search, check the match result against the expected results.
+        //
+        foundMatch= usearch_search(uss.getAlias(), 0, &foundStart, &foundLimit, &status);
+        TEST_ASSERT_SUCCESS(status);
+        if ((foundMatch && expectedMatchStart<0) ||
+            (foundStart != expectedMatchStart)   ||
+            (foundLimit != expectedMatchLimit)) {
+                TEST_ASSERT(FALSE);   //  ouput generic error position
+                infoln("Found, expected match start = %d, %d \n"
+                       "Found, expected match limit = %d, %d",
+                foundStart, expectedMatchStart, foundLimit, expectedMatchLimit);
+        }
+
+        // In case there are other matches...
+        // (should we only do this if the test case passed?)
+        while (foundMatch) {
+            expectedMatchStart = foundStart;
+            expectedMatchLimit = foundLimit;
+
+            foundMatch = usearch_search(uss.getAlias(), foundLimit, &foundStart, &foundLimit, &status);
+        }
+
+        uss.adoptInstead(usearch_openFromCollator(pattern.getBuffer(), pattern.length(),
+            target.getBuffer(), target.length(),
+            collator.getAlias(),
+            NULL,
+            &status));
+
+        //
+        // Do the backwards search, check the match result against the expected results.
+        //
+        foundMatch= usearch_searchBackwards(uss.getAlias(), target.length(), &foundStart, &foundLimit, &status);
+        TEST_ASSERT_SUCCESS(status);
+        if ((foundMatch && expectedMatchStart<0) ||
+            (foundStart != expectedMatchStart)   ||
+            (foundLimit != expectedMatchLimit)) {
+                TEST_ASSERT(FALSE);   //  ouput generic error position
+                infoln("Found, expected backwards match start = %d, %d \n"
+                       "Found, expected backwards match limit = %d, %d",
+                foundStart, expectedMatchStart, foundLimit, expectedMatchLimit);
+        }
+    }
+#endif
+}
+
+struct UdhrTestCase
+{
+    const char *locale;
+    const char *file;
+};
+
+void SSearchTest::udhrTest()
+{
+    UErrorCode status = U_ZERO_ERROR;
+    char path[PATH_BUFFER_SIZE];
+    const char *udhrPath = getPath(path, "udhr");
+
+    if (udhrPath == NULL) {
+        // couldn't get path: error message already output...
+        return;
+    }
+
+    UdhrTestCase testCases[] = {
+        {"en", "udhr_eng.txt"},
+        {"de", "udhr_deu_1996.txt"},
+        {"fr", "udhr_fra.txt"},
+        {"ru", "udhr_rus.txt"},
+        {"th", "udhr_tha.txt"},
+        {"ja", "udhr_jpn.txt"},
+        {"ko", "udhr_kor.txt"},
+        {"zh", "udhr_cmn_hans.txt"},
+        {"zh_Hant", "udhr_cmn_hant.txt"}
+    };
+
+    int32_t testCount = ARRAY_SIZE(testCases);
+
+    for (int32_t t = 0; t < testCount; t += 1) {
+        int32_t len = 0;
+        char *resolvedFileName = NULL;
+        const char *encoding = NULL;
+        UCHARBUF *ucharBuf = NULL;
+
+        ucbuf_resolveFileName(udhrPath, testCases[t].file, NULL, &len, &status);
+        resolvedFileName = NEW_ARRAY(char, len);
+
+        if(resolvedFileName == NULL){
+            continue;
+        }
+
+        if(status == U_BUFFER_OVERFLOW_ERROR){
+            status = U_ZERO_ERROR;
+        }
+
+        ucbuf_resolveFileName(udhrPath, testCases[t].file, resolvedFileName, &len, &status);
+        ucharBuf = ucbuf_open(resolvedFileName, &encoding, TRUE, FALSE, &status);
+
+        DELETE_ARRAY(resolvedFileName);
+
+        if(U_FAILURE(status)){
+            infoln("Could not open the input file %s. Test skipped\n", testCases[t].file);
+            continue;
+        }
+
+        int32_t targetLen = 0;
+        const UChar *target = ucbuf_getBuffer(ucharBuf, &targetLen, &status);
+
+        /* The first line of the file contains the pattern */
+        int32_t start = 0, end = 0, plen = 0;
+
+        for(end = start; ; end += 1) {
+            UChar ch = target[end];
+
+            if (ch == 0x000A || ch == 0x000D || ch == 0x2028) {
+                break;
+            }
+        }
+
+        plen = end - start;
+
+        UChar *pattern = NEW_ARRAY(UChar, plen);
+        for (int32_t i = 0; i < plen; i += 1) {
+            pattern[i] =  target[start++];
+        }
+
+        int32_t offset = 0;
+        UCollator *coll = ucol_open(testCases[t].locale, &status);
+        UCD *ucd = NULL;
+        BMS *bms = NULL;
+
+        if (U_FAILURE(status)) {
+            errln("Could not open collator for %s", testCases[t].locale);
+            goto delete_collator;
+        }
+
+        ucd = ucd_open(coll, &status);
+
+        if (U_FAILURE(status)) {
+            errln("Could not open CollData object for %s", testCases[t].locale);
+            goto delete_ucd;
+        }
+
+        bms = bms_open(ucd, pattern, plen, target, targetLen, &status);
+
+        if (U_FAILURE(status)) {
+            errln("Could not open search object for %s", testCases[t].locale);
+            goto delete_bms;
+        }
+
+        start = end = -1;
+        while (bms_search(bms, offset, &start, &end)) {
+            offset = end;
+        }
+
+        if (offset == 0) {
+            errln("Could not find pattern - locale: %s, file: %s ", testCases[t].locale, testCases[t].file);
+        }
+
+delete_bms:
+        bms_close(bms);
+
+delete_ucd:
+        ucd_close(ucd);
+
+delete_collator:
+        ucol_close(coll);
+
+        DELETE_ARRAY(pattern);
+        ucbuf_close(ucharBuf);
+    }
+
+    ucd_flushCache();
+}
+
+void SSearchTest::bmSearchTest()
+{
+#if !UCONFIG_NO_REGULAR_EXPRESSIONS
+    UErrorCode status = U_ZERO_ERROR;
+    char path[PATH_BUFFER_SIZE];
+    const char *testFilePath = getPath(path, "ssearch.xml");
+
+    if (testFilePath == NULL) {
+        return; /* Couldn't get path: error message already output. */
+    }
+
+    UXMLParser  *parser = UXMLParser::createParser(status);
+    TEST_ASSERT_SUCCESS(status);
+    UXMLElement *root   = parser->parseFile(testFilePath, status);
+    TEST_ASSERT_SUCCESS(status);
+    if (U_FAILURE(status)) {
+        return;
+    }
+
+    const UnicodeString *debugTestCase = root->getAttribute("debug");
+    if (debugTestCase != NULL) {
+//       setenv("USEARCH_DEBUG", "1", 1);
+    }
+
+
+    const UXMLElement *testCase;
+    int32_t tc = 0;
+
+    while((testCase = root->nextChildElement(tc)) != NULL) {
+
+        if (testCase->getTagName().compare("test-case") != 0) {
+            errln("ssearch, unrecognized XML Element in test file");
+            continue;
+        }
+        const UnicodeString *id       = testCase->getAttribute("id");
+        *testId = 0;
+        if (id != NULL) {
+            id->extract(0, id->length(), testId,  sizeof(testId), US_INV);
+        }
+
+        // If debugging test case has been specified and this is not it, skip to next.
+        if (id!=NULL && debugTestCase!=NULL && *id != *debugTestCase) {
+            continue;
+        }
+        //
+        //  Get the requested collation strength.
+        //    Default is tertiary if the XML attribute is missing from the test case.
+        //
+        const UnicodeString *strength = testCase->getAttribute("strength");
+        UColAttributeValue collatorStrength = UCOL_PRIMARY;
+        if      (strength==NULL)          { collatorStrength = UCOL_TERTIARY;}
+        else if (*strength=="PRIMARY")    { collatorStrength = UCOL_PRIMARY;}
+        else if (*strength=="SECONDARY")  { collatorStrength = UCOL_SECONDARY;}
+        else if (*strength=="TERTIARY")   { collatorStrength = UCOL_TERTIARY;}
+        else if (*strength=="QUATERNARY") { collatorStrength = UCOL_QUATERNARY;}
+        else if (*strength=="IDENTICAL")  { collatorStrength = UCOL_IDENTICAL;}
+        else {
+            // Bogus value supplied for strength.  Shouldn't happen, even from
+            //  typos, if the  XML source has been validated.
+            //  This assert is a little deceiving in that strength can be
+            //   any of the allowed values, not just TERTIARY, but it will
+            //   do the job of getting the error output.
+            TEST_ASSERT(*strength=="TERTIARY")
+        }
+
+        //
+        // Get the collator normalization flag.  Default is UCOL_OFF.
+        //
+        UColAttributeValue normalize = UCOL_OFF;
+        const UnicodeString *norm = testCase->getAttribute("norm");
+        TEST_ASSERT (norm==NULL || *norm=="ON" || *norm=="OFF");
+        if (norm!=NULL && *norm=="ON") {
+            normalize = UCOL_ON;
+        }
+
+        //
+        // Get the alternate_handling flag. Default is UCOL_NON_IGNORABLE.
+        //
+        UColAttributeValue alternateHandling = UCOL_NON_IGNORABLE;
+        const UnicodeString *alt = testCase->getAttribute("alternate_handling");
+        TEST_ASSERT (alt == NULL || *alt == "SHIFTED" || *alt == "NON_IGNORABLE");
+        if (alt != NULL && *alt == "SHIFTED") {
+            alternateHandling = UCOL_SHIFTED;
+        }
+
+        const UnicodeString defLocale("en");
+        char  clocale[100];
+        const UnicodeString *locale   = testCase->getAttribute("locale");
+        if (locale == NULL || locale->length()==0) {
+            locale = &defLocale;
+        };
+        locale->extract(0, locale->length(), clocale, sizeof(clocale), NULL);
+
+
+        UnicodeString  text;
+        UnicodeString  target;
+        UnicodeString  pattern;
+        int32_t        expectedMatchStart = -1;
+        int32_t        expectedMatchLimit = -1;
+        const UXMLElement  *n;
+        int32_t                nodeCount = 0;
+
+        n = testCase->getChildElement("pattern");
+        TEST_ASSERT(n != NULL);
+        if (n==NULL) {
+            continue;
+        }
+        text = n->getText(FALSE);
+        text = text.unescape();
+        pattern.append(text);
+        nodeCount++;
+
+        n = testCase->getChildElement("pre");
+        if (n!=NULL) {
+            text = n->getText(FALSE);
+            text = text.unescape();
+            target.append(text);
+            nodeCount++;
+        }
+
+        n = testCase->getChildElement("m");
+        if (n!=NULL) {
+            expectedMatchStart = target.length();
+            text = n->getText(FALSE);
+            text = text.unescape();
+            target.append(text);
+            expectedMatchLimit = target.length();
+            nodeCount++;
+        }
+
+        n = testCase->getChildElement("post");
+        if (n!=NULL) {
+            text = n->getText(FALSE);
+            text = text.unescape();
+            target.append(text);
+            nodeCount++;
+        }
+
+        //  Check that there weren't extra things in the XML
+        TEST_ASSERT(nodeCount == testCase->countChildren());
+
+        // Open a collator and StringSearch based on the parameters
+        //   obtained from the XML.
+        //
+        status = U_ZERO_ERROR;
+        UCollator *collator = ucol_open(clocale, &status);
+        ucol_setStrength(collator, collatorStrength);
+        ucol_setAttribute(collator, UCOL_NORMALIZATION_MODE, normalize, &status);
+        ucol_setAttribute(collator, UCOL_ALTERNATE_HANDLING, alternateHandling, &status);
+        UCD *ucd = ucd_open(collator, &status);
+        BMS *bms = bms_open(ucd, pattern.getBuffer(), pattern.length(), target.getBuffer(), target.length(), &status);
+
+        TEST_ASSERT_SUCCESS(status);
+        if (U_FAILURE(status)) {
+            bms_close(bms);
+            ucd_close(ucd);
+            ucol_close(collator);
+            continue;
+        }
+
+        int32_t foundStart = 0;
+        int32_t foundLimit = 0;
+        UBool   foundMatch;
+
+        //
+        // Do the search, check the match result against the expected results.
+        //
+        foundMatch = bms_search(bms, 0, &foundStart, &foundLimit);
+      //TEST_ASSERT_SUCCESS(status);
+        if ((foundMatch && expectedMatchStart < 0) ||
+            (foundStart != expectedMatchStart)     ||
+            (foundLimit != expectedMatchLimit)) {
+                TEST_ASSERT(FALSE);   //  ouput generic error position
+                infoln("Found, expected match start = %d, %d \n"
+                       "Found, expected match limit = %d, %d",
+                foundStart, expectedMatchStart, foundLimit, expectedMatchLimit);
+        }
+
+        bms_close(bms);
+        ucd_close(ucd);
+        ucol_close(collator);
+    }
+
+    ucd_flushCache();
+    delete root;
+    delete parser;
+#endif
+}
+
+struct Order
+{
+    int32_t order;
+    int32_t lowOffset;
+    int32_t highOffset;
+};
+
+class OrderList
+{
+public:
+    OrderList();
+    OrderList(UCollator *coll, const UnicodeString &string, int32_t stringOffset = 0);
+    ~OrderList();
+
+    int32_t size(void) const;
+    void add(int32_t order, int32_t low, int32_t high);
+    const Order *get(int32_t index) const;
+    int32_t getLowOffset(int32_t index) const;
+    int32_t getHighOffset(int32_t index) const;
+    int32_t getOrder(int32_t index) const;
+    void reverse(void);
+    UBool compare(const OrderList &other) const;
+    UBool matchesAt(int32_t offset, const OrderList &other) const;
+
+private:
+    Order *list;
+    int32_t listMax;
+    int32_t listSize;
+};
+
+OrderList::OrderList()
+  : list(NULL),  listMax(16), listSize(0)
+{
+    list = new Order[listMax];
+}
+
+OrderList::OrderList(UCollator *coll, const UnicodeString &string, int32_t stringOffset)
+    : list(NULL), listMax(16), listSize(0)
+{
+    UErrorCode status = U_ZERO_ERROR;
+    UCollationElements *elems = ucol_openElements(coll, string.getBuffer(), string.length(), &status);
+    uint32_t strengthMask = 0;
+    int32_t order, low, high;
+
+    switch (ucol_getStrength(coll))
+    {
+    default:
+        strengthMask |= UCOL_TERTIARYORDERMASK;
+        /* fall through */
+
+    case UCOL_SECONDARY:
+        strengthMask |= UCOL_SECONDARYORDERMASK;
+        /* fall through */
+
+    case UCOL_PRIMARY:
+        strengthMask |= UCOL_PRIMARYORDERMASK;
+    }
+
+    list = new Order[listMax];
+
+    ucol_setOffset(elems, stringOffset, &status);
+
+    do {
+        low   = ucol_getOffset(elems);
+        order = ucol_next(elems, &status);
+        high  = ucol_getOffset(elems);
+
+        if (order != UCOL_NULLORDER) {
+            order &= strengthMask;
+        }
+
+        if (order != UCOL_IGNORABLE) {
+            add(order, low, high);
+        }
+    } while (order != UCOL_NULLORDER);
+
+    ucol_closeElements(elems);
+}
+
+OrderList::~OrderList()
+{
+    delete[] list;
+}
+
+void OrderList::add(int32_t order, int32_t low, int32_t high)
+{
+    if (listSize >= listMax) {
+        listMax *= 2;
+
+        Order *newList = new Order[listMax];
+
+        uprv_memcpy(newList, list, listSize * sizeof(Order));
+        delete[] list;
+        list = newList;
+    }
+
+    list[listSize].order      = order;
+    list[listSize].lowOffset  = low;
+    list[listSize].highOffset = high;
+
+    listSize += 1;
+}
+
+const Order *OrderList::get(int32_t index) const
+{
+    if (index >= listSize) {
+        return NULL;
+    }
+
+    return &list[index];
+}
+
+int32_t OrderList::getLowOffset(int32_t index) const
+{
+    const Order *order = get(index);
+
+    if (order != NULL) {
+        return order->lowOffset;
+    }
+
+    return -1;
+}
+
+int32_t OrderList::getHighOffset(int32_t index) const
+{
+    const Order *order = get(index);
+
+    if (order != NULL) {
+        return order->highOffset;
+    }
+
+    return -1;
+}
+
+int32_t OrderList::getOrder(int32_t index) const
+{
+    const Order *order = get(index);
+
+    if (order != NULL) {
+        return order->order;
+    }
+
+    return UCOL_NULLORDER;
+}
+
+int32_t OrderList::size() const
+{
+    return listSize;
+}
+
+void OrderList::reverse()
+{
+    for(int32_t f = 0, b = listSize - 1; f < b; f += 1, b -= 1) {
+        Order swap = list[b];
+
+        list[b] = list[f];
+        list[f] = swap;
+    }
+}
+
+UBool OrderList::compare(const OrderList &other) const
+{
+    if (listSize != other.listSize) {
+        return FALSE;
+    }
+
+    for(int32_t i = 0; i < listSize; i += 1) {
+        if (list[i].order  != other.list[i].order ||
+            list[i].lowOffset != other.list[i].lowOffset ||
+            list[i].highOffset != other.list[i].highOffset) {
+                return FALSE;
+        }
+    }
+
+    return TRUE;
+}
+
+UBool OrderList::matchesAt(int32_t offset, const OrderList &other) const
+{
+    // NOTE: sizes include the NULLORDER, which we don't want to compare.
+    int32_t otherSize = other.size() - 1;
+
+    if (listSize - 1 - offset < otherSize) {
+        return FALSE;
+    }
+
+    for (int32_t i = offset, j = 0; j < otherSize; i += 1, j += 1) {
+        if (getOrder(i) != other.getOrder(j)) {
+            return FALSE;
+        }
+    }
+
+    return TRUE;
+}
+
+static char *printOffsets(char *buffer, OrderList &list)
+{
+    int32_t size = list.size();
+    char *s = buffer;
+
+    for(int32_t i = 0; i < size; i += 1) {
+        const Order *order = list.get(i);
+
+        if (i != 0) {
+            s += sprintf(s, ", ");
+        }
+
+        s += sprintf(s, "(%d, %d)", order->lowOffset, order->highOffset);
+    }
+
+    return buffer;
+}
+
+static char *printOrders(char *buffer, OrderList &list)
+{
+    int32_t size = list.size();
+    char *s = buffer;
+
+    for(int32_t i = 0; i < size; i += 1) {
+        const Order *order = list.get(i);
+
+        if (i != 0) {
+            s += sprintf(s, ", ");
+        }
+
+        s += sprintf(s, "%8.8X", order->order);
+    }
+
+    return buffer;
+}
+
+void SSearchTest::offsetTest()
+{
+    static const UVersionInfo icu47 = { 4, 7, 0, 0 };
+    const char *test[] = {
+        // The sequence \u0FB3\u0F71\u0F71\u0F80 contains a discontiguous
+        // contraction (\u0FB3\u0F71\u0F80) logically followed by \u0F71.
+        "\\u1E33\\u0FB3\\u0F71\\u0F71\\u0F80\\uD835\\uDF6C\\u01B0",
+
+        "\\ua191\\u16ef\\u2036\\u017a",
+
+#if 0
+        // This results in a complex interaction between contraction,
+        // expansion and normalization that confuses the backwards offset fixups.
+        "\\u0F7F\\u0F80\\u0F81\\u0F82\\u0F83\\u0F84\\u0F85",
+#endif
+
+        "\\u0F80\\u0F81\\u0F82\\u0F83\\u0F84\\u0F85",
+        "\\u07E9\\u07EA\\u07F1\\u07F2\\u07F3",
+
+        "\\u02FE\\u02FF"
+        "\\u0300\\u0301\\u0302\\u0303\\u0304\\u0305\\u0306\\u0307\\u0308\\u0309\\u030A\\u030B\\u030C\\u030D\\u030E\\u030F"
+        "\\u0310\\u0311\\u0312\\u0313\\u0314\\u0315\\u0316\\u0317\\u0318\\u0319\\u031A\\u031B\\u031C\\u031D\\u031E\\u031F"
+        "\\u0320\\u0321\\u0322\\u0323\\u0324\\u0325\\u0326\\u0327\\u0328\\u0329\\u032A\\u032B\\u032C\\u032D\\u032E\\u032F"
+        "\\u0330\\u0331\\u0332\\u0333\\u0334\\u0335\\u0336\\u0337\\u0338\\u0339\\u033A\\u033B\\u033C\\u033D\\u033E\\u033F"
+        "\\u0340\\u0341\\u0342\\u0343\\u0344\\u0345\\u0346\\u0347\\u0348\\u0349\\u034A\\u034B\\u034C\\u034D\\u034E", // currently not working, see #8081
+
+        "\\u02FE\\u02FF\\u0300\\u0301\\u0302\\u0303\\u0316\\u0317\\u0318", // currently not working, see #8081
+        "a\\u02FF\\u0301\\u0316", // currently not working, see #8081
+        "a\\u02FF\\u0316\\u0301",
+        "a\\u0430\\u0301\\u0316",
+        "a\\u0430\\u0316\\u0301",
+        "abc\\u0E41\\u0301\\u0316",
+        "abc\\u0E41\\u0316\\u0301",
+        "\\u0E41\\u0301\\u0316",
+        "\\u0E41\\u0316\\u0301",
+        "a\\u0301\\u0316",
+        "a\\u0316\\u0301",
+        "\\uAC52\\uAC53",
+        "\\u34CA\\u34CB",
+        "\\u11ED\\u11EE",
+        "\\u30C3\\u30D0",
+        "p\\u00E9ch\\u00E9",
+        "a\\u0301\\u0325",
+        "a\\u0300\\u0325",
+        "a\\u0325\\u0300",
+        "A\\u0323\\u0300B",
+        "A\\u0300\\u0323B",
+        "A\\u0301\\u0323B",
+        "A\\u0302\\u0301\\u0323B",
+        "abc",
+        "ab\\u0300c",
+        "ab\\u0300\\u0323c",
+        " \\uD800\\uDC00\\uDC00",
+        "a\\uD800\\uDC00\\uDC00",
+        "A\\u0301\\u0301",
+        "A\\u0301\\u0323",
+        "A\\u0301\\u0323B",
+        "B\\u0301\\u0323C",
+        "A\\u0300\\u0323B",
+        "\\u0301A\\u0301\\u0301",
+        "abcd\\r\\u0301",
+        "p\\u00EAche",
+        "pe\\u0302che",
+    };
+
+    int32_t testCount = ARRAY_SIZE(test);
+    UErrorCode status = U_ZERO_ERROR;
+    RuleBasedCollator *col = (RuleBasedCollator *) Collator::createInstance(Locale::getEnglish(), status);
+    if (U_FAILURE(status)) {
+        errcheckln(status, "Failed to create collator in offsetTest! - %s", u_errorName(status));
+        return;
+    }
+    char buffer[4096];  // A bit of a hack... just happens to be long enough for all the test cases...
+                        // We could allocate one that's the right size by (CE_count * 10) + 2
+                        // 10 chars is enough room for 8 hex digits plus ", ". 2 extra chars for "[" and "]"
+
+    col->setAttribute(UCOL_NORMALIZATION_MODE, UCOL_ON, status);
+
+    for(int32_t i = 0; i < testCount; i += 1) {
+        if (!isICUVersionAtLeast(icu47) && i>=4 && i<=6) {
+            continue; // timebomb until ticket #8080 is resolved
+        }
+        UnicodeString ts = CharsToUnicodeString(test[i]);
+        CollationElementIterator *iter = col->createCollationElementIterator(ts);
+        OrderList forwardList;
+        OrderList backwardList;
+        int32_t order, low, high;
+
+        do {
+            low   = iter->getOffset();
+            order = iter->next(status);
+            high  = iter->getOffset();
+
+            forwardList.add(order, low, high);
+        } while (order != CollationElementIterator::NULLORDER);
+
+        iter->reset();
+        iter->setOffset(ts.length(), status);
+
+        backwardList.add(CollationElementIterator::NULLORDER, iter->getOffset(), iter->getOffset());
+
+        do {
+            high  = iter->getOffset();
+            order = iter->previous(status);
+            low   = iter->getOffset();
+
+            if (order == CollationElementIterator::NULLORDER) {
+                break;
+            }
+
+            backwardList.add(order, low, high);
+        } while (TRUE);
+
+        backwardList.reverse();
+
+        if (forwardList.compare(backwardList)) {
+            logln("Works with \"%s\"", test[i]);
+            logln("Forward offsets:  [%s]", printOffsets(buffer, forwardList));
+//          logln("Backward offsets: [%s]", printOffsets(buffer, backwardList));
+
+            logln("Forward CEs:  [%s]", printOrders(buffer, forwardList));
+//          logln("Backward CEs: [%s]", printOrders(buffer, backwardList));
+
+            logln();
+        } else {
+            errln("Fails with \"%s\"", test[i]);
+            infoln("Forward offsets:  [%s]", printOffsets(buffer, forwardList));
+            infoln("Backward offsets: [%s]", printOffsets(buffer, backwardList));
+
+            infoln("Forward CEs:  [%s]", printOrders(buffer, forwardList));
+            infoln("Backward CEs: [%s]", printOrders(buffer, backwardList));
+
+            infoln();
+        }
+        delete iter;
+    }
+    delete col;
+}
+
+#if 0
+static UnicodeString &escape(const UnicodeString &string, UnicodeString &buffer)
+{
+    for(int32_t i = 0; i < string.length(); i += 1) {
+        UChar32 ch = string.char32At(i);
+
+        if (ch >= 0x0020 && ch <= 0x007F) {
+            if (ch == 0x005C) {
+                buffer.append("\\\\");
+            } else {
+                buffer.append(ch);
+            }
+        } else {
+            char cbuffer[12];
+
+            if (ch <= 0xFFFFL) {
+                sprintf(cbuffer, "\\u%4.4X", ch);
+            } else {
+                sprintf(cbuffer, "\\U%8.8X", ch);
+            }
+
+            buffer.append(cbuffer);
+        }
+
+        if (ch >= 0x10000L) {
+            i += 1;
+        }
+    }
+
+    return buffer;
+}
+#endif
+
+#if 1
+
+struct PCE
+{
+    uint64_t ce;
+    int32_t  lowOffset;
+    int32_t  highOffset;
+};
+
+class PCEList
+{
+public:
+    PCEList(UCollator *coll, const UnicodeString &string);
+    ~PCEList();
+
+    int32_t size() const;
+
+    const PCE *get(int32_t index) const;
+
+    int32_t getLowOffset(int32_t index) const;
+    int32_t getHighOffset(int32_t index) const;
+    uint64_t getOrder(int32_t index) const;
+
+    UBool matchesAt(int32_t offset, const PCEList &other) const;
+
+    uint64_t operator[](int32_t index) const;
+
+private:
+    void add(uint64_t ce, int32_t low, int32_t high);
+
+    PCE *list;
+    int32_t listMax;
+    int32_t listSize;
+};
+
+PCEList::PCEList(UCollator *coll, const UnicodeString &string)
+{
+    UErrorCode status = U_ZERO_ERROR;
+    UCollationElements *elems = ucol_openElements(coll, string.getBuffer(), string.length(), &status);
+    uint64_t order;
+    int32_t low, high;
+
+    list = new PCE[listMax];
+
+    ucol_setOffset(elems, 0, &status);
+
+    do {
+        order = ucol_nextProcessed(elems, &low, &high, &status);
+        add(order, low, high);
+    } while (order != UCOL_PROCESSED_NULLORDER);
+
+    ucol_closeElements(elems);
+}
+
+PCEList::~PCEList()
+{
+    delete[] list;
+}
+
+void PCEList::add(uint64_t order, int32_t low, int32_t high)
+{
+    if (listSize >= listMax) {
+        listMax *= 2;
+
+        PCE *newList = new PCE[listMax];
+
+        uprv_memcpy(newList, list, listSize * sizeof(Order));
+        delete[] list;
+        list = newList;
+    }
+
+    list[listSize].ce         = order;
+    list[listSize].lowOffset  = low;
+    list[listSize].highOffset = high;
+
+    listSize += 1;
+}
+
+const PCE *PCEList::get(int32_t index) const
+{
+    if (index >= listSize) {
+        return NULL;
+    }
+
+    return &list[index];
+}
+
+int32_t PCEList::getLowOffset(int32_t index) const
+{
+    const PCE *pce = get(index);
+
+    if (pce != NULL) {
+        return pce->lowOffset;
+    }
+
+    return -1;
+}
+
+int32_t PCEList::getHighOffset(int32_t index) const
+{
+    const PCE *pce = get(index);
+
+    if (pce != NULL) {
+        return pce->highOffset;
+    }
+
+    return -1;
+}
+
+uint64_t PCEList::getOrder(int32_t index) const
+{
+    const PCE *pce = get(index);
+
+    if (pce != NULL) {
+        return pce->ce;
+    }
+
+    return UCOL_PROCESSED_NULLORDER;
+}
+
+int32_t PCEList::size() const
+{
+    return listSize;
+}
+
+UBool PCEList::matchesAt(int32_t offset, const PCEList &other) const
+{
+    // NOTE: sizes include the NULLORDER, which we don't want to compare.
+    int32_t otherSize = other.size() - 1;
+
+    if (listSize - 1 - offset < otherSize) {
+        return FALSE;
+    }
+
+    for (int32_t i = offset, j = 0; j < otherSize; i += 1, j += 1) {
+        if (getOrder(i) != other.getOrder(j)) {
+            return FALSE;
+        }
+    }
+
+    return TRUE;
+}
+
+uint64_t PCEList::operator[](int32_t index) const
+{
+    return getOrder(index);
+}
+
+void SSearchTest::boyerMooreTest()
+{
+    UErrorCode status = U_ZERO_ERROR;
+    UCollator *coll = NULL;
+    CollData *data = NULL;
+    const CEList* ce = NULL;
+    const CEList* ce1 = NULL;
+    UnicodeString lp  = "fuss";
+    UnicodeString sp = "fu\\u00DF";
+    BoyerMooreSearch *longPattern = NULL;
+    BoyerMooreSearch *shortPattern = NULL;
+    UnicodeString targets[]  = {"fu\\u00DF", "fu\\u00DFball", "1fu\\u00DFball", "12fu\\u00DFball", "123fu\\u00DFball", "1234fu\\u00DFball",
+                                "ffu\\u00DF", "fufu\\u00DF", "fusfu\\u00DF",
+                                "fuss", "ffuss", "fufuss", "fusfuss", "1fuss", "12fuss", "123fuss", "1234fuss", "fu\\u00DF", "1fu\\u00DF", "12fu\\u00DF", "123fu\\u00DF", "1234fu\\u00DF"};
+    int32_t start = -1, end = -1;
+
+    coll = ucol_openFromShortString("LEN_S1", FALSE, NULL, &status);
+    if (U_FAILURE(status)) {
+        errcheckln(status, "Could not open collator. - %s", u_errorName(status));
+        return;
+    }
+
+    data = CollData::open(coll, status);
+    if (U_FAILURE(status)) {
+        errln("Could not open CollData object.");
+        goto close_data;
+    }
+
+    data->getDynamicClassID();
+    if (U_FAILURE(status)) {
+        errln("Could not get dynamic class ID of CollData.");
+        goto close_patterns;
+    }
+
+    data->getStaticClassID();
+    if (U_FAILURE(status)) {
+        errln("Could not get static class ID of CollData.");
+        goto close_patterns;
+    }
+
+    longPattern = new BoyerMooreSearch(data, lp.unescape(), NULL, status);
+    shortPattern = new BoyerMooreSearch(data, sp.unescape(), NULL, status);
+    if (U_FAILURE(status)) {
+        errln("Could not create pattern objects.");
+        goto close_patterns;
+    }
+
+    longPattern->getBadCharacterTable();
+    shortPattern->getBadCharacterTable();
+    if (U_FAILURE(status)) {
+        errln("Could not get bad character table.");
+        goto close_patterns;
+    }
+
+    longPattern->getGoodSuffixTable();
+    shortPattern->getGoodSuffixTable();
+    if (U_FAILURE(status)) {
+        errln("Could not get good suffix table.");
+        goto close_patterns;
+    }
+
+    longPattern->getDynamicClassID();
+    shortPattern->getDynamicClassID();
+    if (U_FAILURE(status)) {
+        errln("Could not get dynamic class ID of BoyerMooreSearch.");
+        goto close_patterns;
+    }
+
+    longPattern->getStaticClassID();
+    shortPattern->getStaticClassID();
+    if (U_FAILURE(status)) {
+        errln("Could not get static class ID of BoyerMooreSearch.");
+        goto close_patterns;
+    }
+
+    longPattern->getData();
+    shortPattern->getData();
+    if (U_FAILURE(status)) {
+        errln("Could not get collate data.");
+        goto close_patterns;
+    }
+
+    ce = longPattern->getPatternCEs();
+    ce1 = shortPattern->getPatternCEs();
+    if (U_FAILURE(status)) {
+        errln("Could not get pattern CEs.");
+        goto close_patterns;
+    }
+
+    ce->getDynamicClassID();
+    ce1->getDynamicClassID();
+    if (U_FAILURE(status)) {
+        errln("Could not get dynamic class ID of CEList.");
+        goto close_patterns;
+    }
+
+    ce->getStaticClassID();
+    ce1->getStaticClassID();
+    if (U_FAILURE(status)) {
+        errln("Could not get static class ID of CEList.");
+        goto close_patterns;
+    }
+
+    if(data->minLengthInChars(ce,0) != 3){
+        errln("Minimal Length in Characters for 'data' with 'ce' was suppose to give 3.");
+        goto close_patterns;
+    }
+
+    if(data->minLengthInChars(ce1,0) != 3){
+        errln("Minimal Length in Characters for 'data' with 'ce1' was suppose to give 3.");
+        goto close_patterns;
+    }
+
+    for (uint32_t t = 0; t < (sizeof(targets)/sizeof(targets[0])); t += 1) {
+        UnicodeString target = targets[t].unescape();
+
+        longPattern->setTargetString(&target, status);
+        if (longPattern->search(0, start, end)) {
+            logln("Test %d: found long pattern at [%d, %d].", t, start, end);
+        } else {
+            errln("Test %d: did not find long pattern.", t);
+        }
+
+        shortPattern->setTargetString(&target, status);
+        if (shortPattern->search(0, start, end)) {
+            logln("Test %d: found short pattern at [%d, %d].", t, start, end);
+        } else {
+            errln("Test %d: did not find short pattern.", t);
+        }
+
+        if(longPattern->empty()){
+            errln("Test %d: Long pattern should not have been empty.");
+        }
+
+        if(shortPattern->empty()){
+            errln("Test %d: Short pattern should not have been empty.");
+        }
+    }
+
+close_patterns:
+    delete shortPattern;
+    delete longPattern;
+
+close_data:
+    CollData::close(data);
+    ucol_close(coll);
+}
+
+void SSearchTest::bmsTest()
+{
+    UErrorCode status = U_ZERO_ERROR;
+    UCollator *coll = NULL;
+    UCD *data = NULL;
+    UnicodeString lp  = "fuss";
+    UnicodeString lpu = lp.unescape();
+    UnicodeString sp  = "fu\\u00DF";
+    UnicodeString spu = sp.unescape();
+    BMS *longPattern = NULL;
+    BMS *shortPattern = NULL;
+    UnicodeString targets[]  = {"fu\\u00DF", "fu\\u00DFball", "1fu\\u00DFball", "12fu\\u00DFball", "123fu\\u00DFball", "1234fu\\u00DFball",
+                                "ffu\\u00DF", "fufu\\u00DF", "fusfu\\u00DF",
+                                "fuss", "ffuss", "fufuss", "fusfuss", "1fuss", "12fuss", "123fuss", "1234fuss", "fu\\u00DF", "1fu\\u00DF", "12fu\\u00DF", "123fu\\u00DF", "1234fu\\u00DF"};
+    int32_t start = -1, end = -1;
+
+    coll = ucol_openFromShortString("LEN_S1", FALSE, NULL, &status);
+    if (U_FAILURE(status)) {
+        errcheckln(status, "Could not open collator. - %s", u_errorName(status));
+        return;
+    }
+
+    data = ucd_open(coll, &status);
+    if (U_FAILURE(status)) {
+        errln("Could not open CollData object.");
+        goto close_data;
+    }
+
+    longPattern = bms_open(data, lpu.getBuffer(), lpu.length(), NULL, 0, &status);
+    shortPattern = bms_open(data, spu.getBuffer(), spu.length(), NULL, 0, &status);
+    if (U_FAILURE(status)) {
+        errln("Couldn't open pattern objects.");
+        goto close_patterns;
+    }
+
+    for (uint32_t t = 0; t < (sizeof(targets)/sizeof(targets[0])); t += 1) {
+        UnicodeString target = targets[t].unescape();
+
+        bms_setTargetString(longPattern, target.getBuffer(), target.length(), &status);
+        if (bms_search(longPattern, 0, &start, &end)) {
+            logln("Test %d: found long pattern at [%d, %d].", t, start, end);
+        } else {
+            errln("Test %d: did not find long pattern.", t);
+        }
+
+        bms_setTargetString(shortPattern, target.getBuffer(), target.length(), &status);
+        if (bms_search(shortPattern, 0, &start, &end)) {
+            logln("Test %d: found short pattern at [%d, %d].", t, start, end);
+        } else {
+            errln("Test %d: did not find short pattern.", t);
+        }
+    }
+
+    /* Add better coverage for bms code. */
+    if(bms_empty(longPattern)) {
+        errln("FAIL: longgPattern is empty.");
+    }
+
+    if (!bms_getData(longPattern)) {
+        errln("FAIL: bms_getData returned NULL.");
+    }
+
+    if (!ucd_getCollator(data)) {
+        errln("FAIL: ucd_getCollator returned NULL.");
+    }
+
+close_patterns:
+    bms_close(shortPattern);
+    bms_close(longPattern);
+
+close_data:
+    ucd_close(data);
+    ucd_freeCache();
+    ucol_close(coll);
+}
+
+void SSearchTest::goodSuffixTest()
+{
+    UErrorCode status = U_ZERO_ERROR;
+    UCollator *coll = NULL;
+    CollData *data = NULL;
+    UnicodeString pat = /*"gcagagag"*/ "fxeld";
+    UnicodeString target = /*"gcatcgcagagagtatacagtacg"*/ "cloveldfxeld";
+    BoyerMooreSearch *pattern = NULL;
+    int32_t start = -1, end = -1;
+
+    coll = ucol_open(NULL, &status);
+    if (U_FAILURE(status)) {
+        errcheckln(status, "Couldn't open collator. - %s", u_errorName(status));
+        return;
+    }
+
+    data = CollData::open(coll, status);
+    if (U_FAILURE(status)) {
+        errln("Couldn't open CollData object.");
+        goto close_data;
+    }
+
+    pattern = new BoyerMooreSearch(data, pat, &target, status);
+    if (U_FAILURE(status)) {
+        errln("Couldn't open pattern object.");
+        goto close_pattern;
+    }
+
+    if (pattern->search(0, start, end)) {
+        logln("Found pattern at [%d, %d].", start, end);
+    } else {
+        errln("Did not find pattern.");
+    }
+
+close_pattern:
+    delete pattern;
+
+close_data:
+    CollData::close(data);
+    ucol_close(coll);
+}
+
+//
+//  searchTime()    A quick and dirty performance test for string search.
+//                  Probably  doesn't really belong as part of intltest, but it
+//                  does check that the search succeeds, and gets the right result,
+//                  so it serves as a functionality test also.
+//
+//                  To run as a perf test, up the loop count, select by commenting
+//                  and uncommenting in the code the operation to be measured,
+//                  rebuild, and measure the running time of this test alone.
+//
+//                     time LD_LIBRARY_PATH=whatever  ./intltest  collate/SSearchTest/searchTime
+//
+void SSearchTest::searchTime() {
+    static const char *longishText =
+"Whylom, as olde stories tellen us,\n"
+"Ther was a duk that highte Theseus:\n"
+"Of Athenes he was lord and governour,\n"
+"And in his tyme swich a conquerour,\n"
+"That gretter was ther noon under the sonne.\n"
+"Ful many a riche contree hadde he wonne;\n"
+"What with his wisdom and his chivalrye,\n"
+"He conquered al the regne of Femenye,\n"
+"That whylom was y-cleped Scithia;\n"
+"And weddede the quene Ipolita,\n"
+"And broghte hir hoom with him in his contree\n"
+"With muchel glorie and greet solempnitee,\n"
+"And eek hir yonge suster Emelye.\n"
+"And thus with victorie and with melodye\n"
+"Lete I this noble duk to Athenes ryde,\n"
+"And al his hoost, in armes, him bisyde.\n"
+"And certes, if it nere to long to here,\n"
+"I wolde han told yow fully the manere,\n"
+"How wonnen was the regne of Femenye\n"
+"By Theseus, and by his chivalrye;\n"
+"And of the grete bataille for the nones\n"
+"Bitwixen Athen's and Amazones;\n"
+"And how asseged was Ipolita,\n"
+"The faire hardy quene of Scithia;\n"
+"And of the feste that was at hir weddinge,\n"
+"And of the tempest at hir hoom-cominge;\n"
+"But al that thing I moot as now forbere.\n"
+"I have, God woot, a large feeld to ere,\n"
+"And wayke been the oxen in my plough.\n"
+"The remenant of the tale is long y-nough.\n"
+"I wol nat letten eek noon of this route;\n"
+"Lat every felawe telle his tale aboute,\n"
+"And lat see now who shal the soper winne;\n"
+"And ther I lefte, I wol ageyn biginne.\n"
+"This duk, of whom I make mencioun,\n"
+"When he was come almost unto the toun,\n"
+"In al his wele and in his moste pryde,\n"
+"He was war, as he caste his eye asyde,\n"
+"Wher that ther kneled in the hye weye\n"
+"A companye of ladies, tweye and tweye,\n"
+"Ech after other, clad in clothes blake; \n"
+"But swich a cry and swich a wo they make,\n"
+"That in this world nis creature livinge,\n"
+"That herde swich another weymentinge;\n"
+"And of this cry they nolde never stenten,\n"
+"Til they the reynes of his brydel henten.\n"
+"'What folk ben ye, that at myn hoomcominge\n"
+"Perturben so my feste with cryinge'?\n"
+"Quod Theseus, 'have ye so greet envye\n"
+"Of myn honour, that thus compleyne and crye? \n"
+"Or who hath yow misboden, or offended?\n"
+"And telleth me if it may been amended;\n"
+"And why that ye ben clothed thus in blak'?\n"
+"The eldest lady of hem alle spak,\n"
+"When she hadde swowned with a deedly chere,\n"
+"That it was routhe for to seen and here,\n"
+"And seyde: 'Lord, to whom Fortune hath yiven\n"
+"Victorie, and as a conquerour to liven,\n"
+"Noght greveth us your glorie and your honour;\n"
+"But we biseken mercy and socour.\n"
+"Have mercy on our wo and our distresse.\n"
+"Som drope of pitee, thurgh thy gentilesse,\n"
+"Up-on us wrecched wommen lat thou falle.\n"
+"For certes, lord, ther nis noon of us alle,\n"
+"That she nath been a duchesse or a quene;\n"
+"Now be we caitifs, as it is wel sene:\n"
+"Thanked be Fortune, and hir false wheel,\n"
+"That noon estat assureth to be weel.\n"
+"And certes, lord, t'abyden your presence,\n"
+"Here in the temple of the goddesse Clemence\n"
+"We han ben waytinge al this fourtenight;\n"
+"Now help us, lord, sith it is in thy might.\n"
+"I wrecche, which that wepe and waille thus,\n"
+"Was whylom wyf to king Capaneus,\n"
+"That starf at Thebes, cursed be that day!\n"
+"And alle we, that been in this array,\n"
+"And maken al this lamentacioun,\n"
+"We losten alle our housbondes at that toun,\n"
+"Whyl that the sege ther-aboute lay.\n"
+"And yet now th'olde Creon, weylaway!\n"
+"The lord is now of Thebes the citee, \n"
+"Fulfild of ire and of iniquitee,\n"
+"He, for despyt, and for his tirannye,\n"
+"To do the dede bodyes vileinye,\n"
+"Of alle our lordes, whiche that ben slawe,\n"
+"Hath alle the bodyes on an heep y-drawe,\n"
+"And wol nat suffren hem, by noon assent,\n"
+"Neither to been y-buried nor y-brent,\n"
+"But maketh houndes ete hem in despyt. zet'\n";
+
+#define TEST_BOYER_MOORE 1
+const char *cPattern = "maketh houndes ete hem";
+//const char *cPattern = "Whylom";
+//const char *cPattern = "zet";
+    const char *testId = "searchTime()";   // for error macros.
+    UnicodeString target = longishText;
+    UErrorCode status = U_ZERO_ERROR;
+
+
+    LocalUCollatorPointer collator(ucol_open("en", &status));
+    CollData *data = CollData::open(collator.getAlias(), status);
+    if (U_FAILURE(status) || collator.isNull() || data == NULL) {
+        errcheckln(status, "Unable to open UCollator or CollData. - %s", u_errorName(status));
+        return;
+    } 
+    //ucol_setStrength(collator.getAlias(), collatorStrength);
+    //ucol_setAttribute(collator.getAlias(), UCOL_NORMALIZATION_MODE, normalize, &status);
+    UnicodeString uPattern = cPattern;
+#ifndef TEST_BOYER_MOORE
+    LocalUStringSearchPointer uss(usearch_openFromCollator(uPattern.getBuffer(), uPattern.length(),
+                                                           target.getBuffer(), target.length(),
+                                                           collator.getAlias(),
+                                                           NULL,     // the break iterator
+                                                           &status));
+    TEST_ASSERT_SUCCESS(status);
+#else
+    BoyerMooreSearch bms(data, uPattern, &target, status);
+    TEST_ASSERT_SUCCESS(status);
+#endif
+
+//  int32_t foundStart;
+//  int32_t foundEnd;
+    UBool   found;
+
+    // Find the match position usgin strstr
+    const char *pm = strstr(longishText, cPattern);
+    TEST_ASSERT_M(pm!=NULL, "No pattern match with strstr");
+    int32_t  refMatchPos = (int32_t)(pm - longishText);
+    int32_t  icuMatchPos;
+    int32_t  icuMatchEnd;
+#ifndef TEST_BOYER_MOORE
+    usearch_search(uss.getAlias(), 0, &icuMatchPos, &icuMatchEnd, &status);
+    TEST_ASSERT_SUCCESS(status);
+#else
+    found = bms.search(0, icuMatchPos, icuMatchEnd);
+#endif
+    TEST_ASSERT_M(refMatchPos == icuMatchPos, "strstr and icu give different match positions.");
+
+    int32_t i;
+    int32_t j=0;
+
+    // Try loopcounts around 100000 to some millions, depending on the operation,
+    //   to get runtimes of at least several seconds.
+    for (i=0; i<10000; i++) {
+#ifndef TEST_BOYER_MOORE
+        found = usearch_search(uss.getAlias(), 0, &icuMatchPos, &icuMatchEnd, &status);
+#else
+        found = bms.search(0, icuMatchPos, icuMatchEnd);
+#endif
+        //TEST_ASSERT_SUCCESS(status);
+        //TEST_ASSERT(found);
+
+        // usearch_setOffset(uss.getAlias(), 0, &status);
+        // icuMatchPos = usearch_next(uss.getAlias(), &status);
+
+         // The i+j stuff is to confuse the optimizer and get it to actually leave the
+         //   call to strstr in place.
+         //pm = strstr(longishText+j, cPattern);
+         //j = (j + i)%5;
+    }
+
+    printf("%ld, %d\n", pm-longishText, j);
+#ifdef TEST_BOYER_MOORE
+    CollData::close(data);
+#endif
+}
+#endif
+
+//----------------------------------------------------------------------------------------
+//
+//   Random Numbers.  Similar to standard lib rand() and srand()
+//                    Not using library to
+//                      1.  Get same results on all platforms.
+//                      2.  Get access to current seed, to more easily reproduce failures.
+//
+//---------------------------------------------------------------------------------------
+static uint32_t m_seed = 1;
+
+static uint32_t m_rand()
+{
+    m_seed = m_seed * 1103515245 + 12345;
+    return (uint32_t)(m_seed/65536) % 32768;
+}
+
+class Monkey
+{
+public:
+    virtual void append(UnicodeString &test, UnicodeString &alternate) = 0;
+
+protected:
+    Monkey();
+    virtual ~Monkey();
+};
+
+Monkey::Monkey()
+{
+    // ook?
+}
+
+Monkey::~Monkey()
+{
+    // ook?
+}
+
+class SetMonkey : public Monkey
+{
+public:
+    SetMonkey(const USet *theSet);
+    ~SetMonkey();
+
+    virtual void append(UnicodeString &test, UnicodeString &alternate);
+
+private:
+    const USet *set;
+};
+
+SetMonkey::SetMonkey(const USet *theSet)
+    : Monkey(), set(theSet)
+{
+    // ook?
+}
+
+SetMonkey::~SetMonkey()
+{
+    //ook...
+}
+
+void SetMonkey::append(UnicodeString &test, UnicodeString &alternate)
+{
+    int32_t size = uset_size(set);
+    int32_t index = m_rand() % size;
+    UChar32 ch = uset_charAt(set, index);
+    UnicodeString str(ch);
+
+    test.append(str);
+    alternate.append(str); // flip case, or some junk?
+}
+
+class StringSetMonkey : public Monkey
+{
+public:
+    StringSetMonkey(const USet *theSet, UCollator *theCollator, CollData *theCollData);
+    ~StringSetMonkey();
+
+    void append(UnicodeString &testCase, UnicodeString &alternate);
+
+private:
+    UnicodeString &generateAlternative(const UnicodeString &testCase, UnicodeString &alternate);
+
+    const USet *set;
+    UCollator  *coll;
+    CollData   *collData;
+};
+
+StringSetMonkey::StringSetMonkey(const USet *theSet, UCollator *theCollator, CollData *theCollData)
+: Monkey(), set(theSet), coll(theCollator), collData(theCollData)
+{
+    // ook.
+}
+
+StringSetMonkey::~StringSetMonkey()
+{
+    // ook?
+}
+
+void StringSetMonkey::append(UnicodeString &testCase, UnicodeString &alternate)
+{
+    int32_t itemCount = uset_getItemCount(set), len = 0;
+    int32_t index = m_rand() % itemCount;
+    UChar32 rangeStart = 0, rangeEnd = 0;
+    UChar buffer[16];
+    UErrorCode err = U_ZERO_ERROR;
+
+    len = uset_getItem(set, index, &rangeStart, &rangeEnd, buffer, 16, &err);
+
+    if (len == 0) {
+        int32_t offset = m_rand() % (rangeEnd - rangeStart + 1);
+        UChar32 ch = rangeStart + offset;
+        UnicodeString str(ch);
+
+        testCase.append(str);
+        generateAlternative(str, alternate);
+    } else if (len > 0) {
+        // should check that len < 16...
+        UnicodeString str(buffer, len);
+
+        testCase.append(str);
+        generateAlternative(str, alternate);
+    } else {
+        // shouldn't happen...
+    }
+}
+
+UnicodeString &StringSetMonkey::generateAlternative(const UnicodeString &testCase, UnicodeString &alternate)
+{
+    // find out shortest string for the longest sequence of ces.
+    // needs to be refined to use dynamic programming, but will be roughly right
+    UErrorCode status = U_ZERO_ERROR;
+    CEList ceList(coll, testCase, status);
+    UnicodeString alt;
+    int32_t offset = 0;
+
+    if (ceList.size() == 0) {
+        return alternate.append(testCase);
+    }
+
+    while (offset < ceList.size()) {
+        int32_t ce = ceList.get(offset);
+        const StringList *strings = collData->getStringList(ce);
+
+        if (strings == NULL) {
+            return alternate.append(testCase);
+        }
+
+        int32_t stringCount = strings->size();
+        int32_t tries = 0;
+
+        // find random string that generates the same CEList
+        const CEList *ceList2 = NULL;
+        const UnicodeString *string = NULL;
+              UBool matches = FALSE;
+
+        do {
+            int32_t s = m_rand() % stringCount;
+
+            if (tries++ > stringCount) {
+                alternate.append(testCase);
+                return alternate;
+            }
+
+            string = strings->get(s);
+            ceList2 = collData->getCEList(string);
+            matches = ceList.matchesAt(offset, ceList2);
+
+            if (! matches) {
+                collData->freeCEList((CEList *) ceList2);
+            }
+        } while (! matches);
+
+        alt.append(*string);
+        offset += ceList2->size();
+        collData->freeCEList(ceList2);
+    }
+
+    const CEList altCEs(coll, alt, status);
+
+    if (ceList.matchesAt(0, &altCEs)) {
+        return alternate.append(alt);
+    }
+
+    return alternate.append(testCase);
+}
+
+static void generateTestCase(UCollator *coll, Monkey *monkeys[], int32_t monkeyCount, UnicodeString &testCase, UnicodeString &alternate)
+{
+    int32_t pieces = (m_rand() % 4) + 1;
+    UErrorCode status = U_ZERO_ERROR;
+    UBool matches;
+
+    do {
+        testCase.remove();
+        alternate.remove();
+        monkeys[0]->append(testCase, alternate);
+
+        for(int32_t piece = 0; piece < pieces; piece += 1) {
+            int32_t monkey = m_rand() % monkeyCount;
+
+            monkeys[monkey]->append(testCase, alternate);
+        }
+
+        const CEList ceTest(coll, testCase, status);
+        const CEList ceAlt(coll, alternate, status);
+
+        matches = ceTest.matchesAt(0, &ceAlt);
+    } while (! matches);
+}
+
+//
+//  Find the next acceptable boundary following the specified starting index
+//     in the target text being searched.
+//      TODO:  refine what is an acceptable boundary.  For the moment,
+//             choose the next position not within a combining sequence.
+//
+#if 0
+static int32_t nextBoundaryAfter(const UnicodeString &string, int32_t startIndex) {
+    const UChar *text = string.getBuffer();
+    int32_t textLen   = string.length();
+
+    if (startIndex >= textLen) {
+        return startIndex;
+    }
+
+    UChar32  c;
+    int32_t  i = startIndex;
+
+    U16_NEXT(text, i, textLen, c);
+
+    // If we are on a control character, stop without looking for combining marks.
+    //    Control characters do not combine.
+    int32_t gcProperty = u_getIntPropertyValue(c, UCHAR_GRAPHEME_CLUSTER_BREAK);
+    if (gcProperty==U_GCB_CONTROL || gcProperty==U_GCB_LF || gcProperty==U_GCB_CR) {
+        return i;
+    }
+
+    // The initial character was not a control, and can thus accept trailing
+    //   combining characters.  Advance over however many of them there are.
+    int32_t  indexOfLastCharChecked;
+
+    for (;;) {
+        indexOfLastCharChecked = i;
+
+        if (i>=textLen) {
+            break;
+        }
+
+        U16_NEXT(text, i, textLen, c);
+        gcProperty = u_getIntPropertyValue(c, UCHAR_GRAPHEME_CLUSTER_BREAK);
+
+        if (gcProperty != U_GCB_EXTEND && gcProperty != U_GCB_SPACING_MARK) {
+            break;
+        }
+    }
+
+    return indexOfLastCharChecked;
+}
+#endif
+
+#if 0
+static UBool isInCombiningSequence(const UnicodeString &string, int32_t index) {
+    const UChar *text = string.getBuffer();
+    int32_t textLen   = string.length();
+
+    if (index>=textLen || index<=0) {
+        return FALSE;
+    }
+
+    // If the character at the current index is not a GRAPHEME_EXTEND
+    //    then we can not be within a combining sequence.
+    UChar32  c;
+    U16_GET(text, 0, index, textLen, c);
+    int32_t gcProperty = u_getIntPropertyValue(c, UCHAR_GRAPHEME_CLUSTER_BREAK);
+    if (gcProperty != U_GCB_EXTEND && gcProperty != U_GCB_SPACING_MARK) {
+        return FALSE;
+    }
+
+    // We are at a combining mark.  If the preceding character is anything
+    //   except a CONTROL, CR or LF, we are in a combining sequence.
+    U16_PREV(text, 0, index, c);
+    gcProperty = u_getIntPropertyValue(c, UCHAR_GRAPHEME_CLUSTER_BREAK);
+
+    return !(gcProperty==U_GCB_CONTROL || gcProperty==U_GCB_LF || gcProperty==U_GCB_CR);
+}
+#endif
+
+static UBool simpleSearch(UCollator *coll, const UnicodeString &target, int32_t offset, const UnicodeString &pattern, int32_t &matchStart, int32_t &matchEnd)
+{
+    UErrorCode      status = U_ZERO_ERROR;
+    OrderList       targetOrders(coll, target, offset);
+    OrderList       patternOrders(coll, pattern);
+    int32_t         targetSize  = targetOrders.size() - 1;
+    int32_t         patternSize = patternOrders.size() - 1;
+    UBreakIterator *charBreakIterator = ubrk_open(UBRK_CHARACTER, ucol_getLocaleByType(coll, ULOC_VALID_LOCALE, &status),
+                                                  target.getBuffer(), target.length(), &status);
+
+    if (patternSize == 0) {
+        // Searching for an empty pattern always fails
+        matchStart = matchEnd = -1;
+        ubrk_close(charBreakIterator);
+        return FALSE;
+    }
+
+    matchStart = matchEnd = -1;
+
+    for(int32_t i = 0; i < targetSize; i += 1) {
+        if (targetOrders.matchesAt(i, patternOrders)) {
+            int32_t start    = targetOrders.getLowOffset(i);
+            int32_t maxLimit = targetOrders.getLowOffset(i + patternSize);
+            int32_t minLimit = targetOrders.getLowOffset(i + patternSize - 1);
+
+            // if the low and high offsets of the first CE in
+            // the match are the same, it means that the match
+            // starts in the middle of an expansion - all but
+            // the first CE of the expansion will have the offset
+            // of the following character.
+            if (start == targetOrders.getHighOffset(i)) {
+                continue;
+            }
+
+            // Make sure match starts on a grapheme boundary
+            if (! ubrk_isBoundary(charBreakIterator, start)) {
+                continue;
+            }
+
+            // If the low and high offsets of the CE after the match
+            // are the same, it means that the match ends in the middle
+            // of an expansion sequence.
+            if (maxLimit == targetOrders.getHighOffset(i + patternSize) &&
+                targetOrders.getOrder(i + patternSize) != UCOL_NULLORDER) {
+                continue;
+            }
+
+            int32_t mend = maxLimit;
+
+            // Find the first grapheme break after the character index
+            // of the last CE in the match. If it's after character index
+            // that's after the last CE in the match, use that index
+            // as the end of the match.
+            if (minLimit < maxLimit) {
+                int32_t nba = ubrk_following(charBreakIterator, minLimit);
+
+                if (nba >= targetOrders.getHighOffset(i + patternSize - 1)) {
+                    mend = nba;
+                }
+            }
+
+            if (mend > maxLimit) {
+                continue;
+            }
+
+            if (! ubrk_isBoundary(charBreakIterator, mend)) {
+                continue;
+            }
+
+            matchStart = start;
+            matchEnd   = mend;
+
+            ubrk_close(charBreakIterator);
+            return TRUE;
+        }
+    }
+
+    ubrk_close(charBreakIterator);
+    return FALSE;
+}
+
+#if !UCONFIG_NO_REGULAR_EXPRESSIONS
+static int32_t  getIntParam(UnicodeString name, UnicodeString &params, int32_t defaultVal) {
+    int32_t val = defaultVal;
+
+    name.append(" *= *(-?\\d+)");
+
+    UErrorCode status = U_ZERO_ERROR;
+    RegexMatcher m(name, params, 0, status);
+
+    if (m.find()) {
+        // The param exists.  Convert the string to an int.
+        char valString[100];
+        int32_t paramLength = m.end(1, status) - m.start(1, status);
+
+        if (paramLength >= (int32_t)(sizeof(valString)-1)) {
+            paramLength = (int32_t)(sizeof(valString)-2);
+        }
+
+        params.extract(m.start(1, status), paramLength, valString, sizeof(valString));
+        val = strtol(valString,  NULL, 10);
+
+        // Delete this parameter from the params string.
+        m.reset();
+        params = m.replaceFirst("", status);
+    }
+
+  //U_ASSERT(U_SUCCESS(status));
+    if (! U_SUCCESS(status)) {
+        val = defaultVal;
+    }
+
+    return val;
+}
+#endif
+
+#if !UCONFIG_NO_COLLATION
+int32_t SSearchTest::monkeyTestCase(UCollator *coll, const UnicodeString &testCase, const UnicodeString &pattern, const UnicodeString &altPattern,
+                                    const char *name, const char *strength, uint32_t seed)
+{
+    UErrorCode status = U_ZERO_ERROR;
+    int32_t actualStart = -1, actualEnd = -1;
+  //int32_t expectedStart = prefix.length(), expectedEnd = prefix.length() + altPattern.length();
+    int32_t expectedStart = -1, expectedEnd = -1;
+    int32_t notFoundCount = 0;
+    LocalUStringSearchPointer uss(usearch_openFromCollator(pattern.getBuffer(), pattern.length(),
+                                                           testCase.getBuffer(), testCase.length(),
+                                                           coll,
+                                                           NULL,     // the break iterator
+                                                           &status));
+
+    // **** TODO: find *all* matches, not just first one ****
+    simpleSearch(coll, testCase, 0, pattern, expectedStart, expectedEnd);
+
+    usearch_search(uss.getAlias(), 0, &actualStart, &actualEnd, &status);
+
+    if (expectedStart >= 0 && (actualStart != expectedStart || actualEnd != expectedEnd)) {
+        errln("Search for <pattern> in <%s> failed: expected [%d, %d], got [%d, %d]\n"
+              "    strength=%s seed=%d",
+              name, expectedStart, expectedEnd, actualStart, actualEnd, strength, seed);
+    }
+
+    if (expectedStart == -1 && actualStart == -1) {
+        notFoundCount += 1;
+    }
+
+    // **** TODO: find *all* matches, not just first one ****
+    simpleSearch(coll, testCase, 0, altPattern, expectedStart, expectedEnd);
+
+    usearch_setPattern(uss.getAlias(), altPattern.getBuffer(), altPattern.length(), &status);
+
+    usearch_search(uss.getAlias(), 0, &actualStart, &actualEnd, &status);
+
+    if (expectedStart >= 0 && (actualStart != expectedStart || actualEnd != expectedEnd)) {
+        errln("Search for <alt_pattern> in <%s> failed: expected [%d, %d], got [%d, %d]\n"
+              "    strength=%s seed=%d",
+              name, expectedStart, expectedEnd, actualStart, actualEnd, strength, seed);
+    }
+
+    if (expectedStart == -1 && actualStart == -1) {
+        notFoundCount += 1;
+    }
+
+    return notFoundCount;
+}
+
+static void hexForUnicodeString(const UnicodeString &ustr, char * cbuf, int32_t cbuflen)
+{
+    int32_t ustri, ustrlen = ustr.length();
+
+    for (ustri = 0; ustri < ustrlen; ++ustri) {
+        if (cbuflen >= 9 /* format width for single code unit(5) + terminating ellipsis(3) + null(1) */) {
+            int len = sprintf(cbuf, " %04X", ustr.charAt(ustri));
+            cbuflen -= len;
+            cbuf += len;
+        } else {
+            if (cbuflen >= 4 /* terminating ellipsis(3) + null(1) */) {
+                sprintf(cbuf, "...");
+            } else if (cbuflen >= 1) {
+                cbuf = 0;
+            }
+            break;
+        }
+    }
+}
+
+int32_t SSearchTest::bmMonkeyTestCase(UCollator *coll, const UnicodeString &testCase, const UnicodeString &pattern, const UnicodeString &altPattern,
+                                    BoyerMooreSearch *bms, BoyerMooreSearch *abms,
+                                    const char *name, const char *strength, uint32_t seed)
+{
+    UErrorCode status = U_ZERO_ERROR;
+    int32_t actualStart = -1, actualEnd = -1;
+  //int32_t expectedStart = prefix.length(), expectedEnd = prefix.length() + altPattern.length();
+    int32_t expectedStart = -1, expectedEnd = -1;
+    int32_t notFoundCount = 0;
+    char    hexbuf[128];
+
+    // **** TODO: find *all* matches, not just first one ****
+    simpleSearch(coll, testCase, 0, pattern, expectedStart, expectedEnd);
+
+    bms->setTargetString(&testCase, status);
+    bms->search(0, actualStart, actualEnd);
+
+    if (expectedStart >= 0 && (actualStart != expectedStart || actualEnd != expectedEnd)) {
+        hexForUnicodeString(pattern, hexbuf, sizeof(hexbuf));
+        errln("Boyer-Moore Search for <pattern> in <%s> failed: expected [%d, %d], got [%d, %d]\n"
+              "    strength=%s seed=%d <pattern>: %s",
+              name, expectedStart, expectedEnd, actualStart, actualEnd, strength, seed, hexbuf);
+    }
+
+    if (expectedStart == -1 && actualStart == -1) {
+        notFoundCount += 1;
+    }
+
+    // **** TODO: find *all* matches, not just first one ****
+    simpleSearch(coll, testCase, 0, altPattern, expectedStart, expectedEnd);
+
+    abms->setTargetString(&testCase, status);
+    abms->search(0, actualStart, actualEnd);
+
+    if (expectedStart >= 0 && (actualStart != expectedStart || actualEnd != expectedEnd)) {
+        hexForUnicodeString(altPattern, hexbuf, sizeof(hexbuf));
+        errln("Boyer-Moore Search for <alt_pattern> in <%s> failed: expected [%d, %d], got [%d, %d]\n"
+              "    strength=%s seed=%d <pattern>: %s",
+              name, expectedStart, expectedEnd, actualStart, actualEnd, strength, seed, hexbuf);
+    }
+
+    if (expectedStart == -1 && actualStart == -1) {
+        notFoundCount += 1;
+    }
+
+
+    return notFoundCount;
+}
+#endif
+
+void SSearchTest::monkeyTest(char *params)
+{
+    // ook!
+    UErrorCode status = U_ZERO_ERROR;
+  //UCollator *coll = ucol_open(NULL, &status);
+    UCollator *coll = ucol_openFromShortString("S1", FALSE, NULL, &status);
+
+    if (U_FAILURE(status)) {
+        errcheckln(status, "Failed to create collator in MonkeyTest! - %s", u_errorName(status));
+        return;
+    }
+
+    CollData  *monkeyData = CollData::open(coll, status);
+
+    USet *expansions   = uset_openEmpty();
+    USet *contractions = uset_openEmpty();
+
+    ucol_getContractionsAndExpansions(coll, contractions, expansions, FALSE, &status);
+
+    U_STRING_DECL(letter_pattern, "[[:letter:]-[:ideographic:]-[:hangul:]]", 39);
+    U_STRING_INIT(letter_pattern, "[[:letter:]-[:ideographic:]-[:hangul:]]", 39);
+    USet *letters = uset_openPattern(letter_pattern, 39, &status);
+    SetMonkey letterMonkey(letters);
+    StringSetMonkey contractionMonkey(contractions, coll, monkeyData);
+    StringSetMonkey expansionMonkey(expansions, coll, monkeyData);
+    UnicodeString testCase;
+    UnicodeString alternate;
+    UnicodeString pattern, altPattern;
+    UnicodeString prefix, altPrefix;
+    UnicodeString suffix, altSuffix;
+
+    Monkey *monkeys[] = {
+        &letterMonkey,
+        &contractionMonkey,
+        &expansionMonkey,
+        &contractionMonkey,
+        &expansionMonkey,
+        &contractionMonkey,
+        &expansionMonkey,
+        &contractionMonkey,
+        &expansionMonkey};
+    int32_t monkeyCount = sizeof(monkeys) / sizeof(monkeys[0]);
+    // int32_t nonMatchCount = 0;
+
+    UCollationStrength strengths[] = {UCOL_PRIMARY, UCOL_SECONDARY, UCOL_TERTIARY};
+    const char *strengthNames[] = {"primary", "secondary", "tertiary"};
+    int32_t strengthCount = sizeof(strengths) / sizeof(strengths[0]);
+    int32_t loopCount = quick? 1000 : 10000;
+    int32_t firstStrength = 0;
+    int32_t lastStrength  = strengthCount - 1; //*/ 0;
+
+    if (params != NULL) {
+#if !UCONFIG_NO_REGULAR_EXPRESSIONS
+        UnicodeString p(params);
+
+        loopCount = getIntParam("loop", p, loopCount);
+        m_seed    = getIntParam("seed", p, m_seed);
+
+        RegexMatcher m(" *strength *= *(primary|secondary|tertiary) *", p, 0, status);
+        if (m.find()) {
+            UnicodeString breakType = m.group(1, status);
+
+            for (int32_t s = 0; s < strengthCount; s += 1) {
+                if (breakType == strengthNames[s]) {
+                    firstStrength = lastStrength = s;
+                    break;
+                }
+            }
+
+            m.reset();
+            p = m.replaceFirst("", status);
+        }
+
+        if (RegexMatcher("\\S", p, 0, status).find()) {
+            // Each option is stripped out of the option string as it is processed.
+            // All options have been checked.  The option string should have been completely emptied..
+            char buf[100];
+            p.extract(buf, sizeof(buf), NULL, status);
+            buf[sizeof(buf)-1] = 0;
+            errln("Unrecognized or extra parameter:  %s\n", buf);
+            return;
+        }
+#else
+        infoln("SSearchTest built with UCONFIG_NO_REGULAR_EXPRESSIONS: ignoring parameters.");
+#endif
+    }
+
+    for(int32_t s = firstStrength; s <= lastStrength; s += 1) {
+        int32_t notFoundCount = 0;
+
+        logln("Setting strength to %s.", strengthNames[s]);
+        ucol_setStrength(coll, strengths[s]);
+
+        // TODO: try alternate prefix and suffix too?
+        // TODO: alterntaes are only equal at primary strength. Is this OK?
+        for(int32_t t = 0; t < loopCount; t += 1) {
+            uint32_t seed = m_seed;
+            // int32_t  nmc = 0;
+
+            generateTestCase(coll, monkeys, monkeyCount, pattern, altPattern);
+            generateTestCase(coll, monkeys, monkeyCount, prefix,  altPrefix);
+            generateTestCase(coll, monkeys, monkeyCount, suffix,  altSuffix);
+
+            // pattern
+            notFoundCount += monkeyTestCase(coll, pattern, pattern, altPattern, "pattern", strengthNames[s], seed);
+
+            testCase.remove();
+            testCase.append(prefix);
+            testCase.append(/*alt*/pattern);
+
+            // prefix + pattern
+            notFoundCount += monkeyTestCase(coll, testCase, pattern, altPattern, "prefix + pattern", strengthNames[s], seed);
+
+            testCase.append(suffix);
+
+            // prefix + pattern + suffix
+            notFoundCount += monkeyTestCase(coll, testCase, pattern, altPattern, "prefix + pattern + suffix", strengthNames[s], seed);
+
+            testCase.remove();
+            testCase.append(pattern);
+            testCase.append(suffix);
+
+            // pattern + suffix
+            notFoundCount += monkeyTestCase(coll, testCase, pattern, altPattern, "pattern + suffix", strengthNames[s], seed);
+        }
+
+       logln("For strength %s the not found count is %d.", strengthNames[s], notFoundCount);
+    }
+
+    uset_close(contractions);
+    uset_close(expansions);
+    uset_close(letters);
+
+    CollData::close(monkeyData);
+
+    ucol_close(coll);
+}
+
+void SSearchTest::bmMonkeyTest(char *params)
+{
+    static const UVersionInfo icu47 = { 4, 7, 0, 0 }; // for timebomb
+    static const UChar skipChars[] = { 0x0E40, 0x0E41, 0x0E42, 0x0E43, 0x0E44, 0xAAB5, 0xAAB6, 0xAAB9, 0xAABB, 0xAABC, 0 }; // for timebomb
+    // ook!
+    UErrorCode status = U_ZERO_ERROR;
+    UCollator *coll = ucol_openFromShortString("LEN_S1", FALSE, NULL, &status);
+
+    if (U_FAILURE(status)) {
+        errcheckln(status, "Failed to create collator in MonkeyTest! - %s", u_errorName(status));
+        return;
+    }
+
+    CollData  *monkeyData = CollData::open(coll, status);
+
+    USet *expansions   = uset_openEmpty();
+    USet *contractions = uset_openEmpty();
+
+    ucol_getContractionsAndExpansions(coll, contractions, expansions, FALSE, &status);
+
+    U_STRING_DECL(letter_pattern, "[[:letter:]-[:ideographic:]-[:hangul:]]", 39);
+    U_STRING_INIT(letter_pattern, "[[:letter:]-[:ideographic:]-[:hangul:]]", 39);
+    USet *letters = uset_openPattern(letter_pattern, 39, &status);
+    SetMonkey letterMonkey(letters);
+    StringSetMonkey contractionMonkey(contractions, coll, monkeyData);
+    StringSetMonkey expansionMonkey(expansions, coll, monkeyData);
+    UnicodeString testCase;
+    UnicodeString alternate;
+    UnicodeString pattern, altPattern;
+    UnicodeString prefix, altPrefix;
+    UnicodeString suffix, altSuffix;
+
+    Monkey *monkeys[] = {
+        &letterMonkey,
+        &contractionMonkey,
+        &expansionMonkey,
+        &contractionMonkey,
+        &expansionMonkey,
+        &contractionMonkey,
+        &expansionMonkey,
+        &contractionMonkey,
+        &expansionMonkey};
+    int32_t monkeyCount = sizeof(monkeys) / sizeof(monkeys[0]);
+    // int32_t nonMatchCount = 0;
+
+    UCollationStrength strengths[] = {UCOL_PRIMARY, UCOL_SECONDARY, UCOL_TERTIARY};
+    const char *strengthNames[] = {"primary", "secondary", "tertiary"};
+    int32_t strengthCount = sizeof(strengths) / sizeof(strengths[0]);
+    int32_t loopCount = quick? 1000 : 10000;
+    int32_t firstStrength = 0;
+    int32_t lastStrength  = strengthCount - 1; //*/ 0;
+
+    if (params != NULL) {
+#if !UCONFIG_NO_REGULAR_EXPRESSIONS
+        UnicodeString p(params);
+
+        loopCount = getIntParam("loop", p, loopCount);
+        m_seed    = getIntParam("seed", p, m_seed);
+
+        RegexMatcher m(" *strength *= *(primary|secondary|tertiary) *", p, 0, status);
+        if (m.find()) {
+            UnicodeString breakType = m.group(1, status);
+
+            for (int32_t s = 0; s < strengthCount; s += 1) {
+                if (breakType == strengthNames[s]) {
+                    firstStrength = lastStrength = s;
+                    break;
+                }
+            }
+
+            m.reset();
+            p = m.replaceFirst("", status);
+        }
+
+        if (RegexMatcher("\\S", p, 0, status).find()) {
+            // Each option is stripped out of the option string as it is processed.
+            // All options have been checked.  The option string should have been completely emptied..
+            char buf[100];
+            p.extract(buf, sizeof(buf), NULL, status);
+            buf[sizeof(buf)-1] = 0;
+            errln("Unrecognized or extra parameter:  %s\n", buf);
+            return;
+        }
+#else
+        infoln("SSearchTest built with UCONFIG_NO_REGULAR_EXPRESSIONS: ignoring parameters.");
+#endif
+    }
+
+    for(int32_t s = firstStrength; s <= lastStrength; s += 1) {
+        int32_t notFoundCount = 0;
+
+        logln("Setting strength to %s.", strengthNames[s]);
+        ucol_setStrength(coll, strengths[s]);
+
+        CollData *data = CollData::open(coll, status);
+
+        UnicodeString skipString(skipChars); // for timebomb
+        UnicodeSet* skipSet = UnicodeSet::createFromAll(skipString); // for timebomb
+        // TODO: try alternate prefix and suffix too?
+        // TODO: alterntaes are only equal at primary strength. Is this OK?
+        for(int32_t t = 0; t < loopCount; t += 1) {
+            uint32_t seed = m_seed;
+            // int32_t  nmc = 0;
+
+            generateTestCase(coll, monkeys, monkeyCount, pattern, altPattern);
+            generateTestCase(coll, monkeys, monkeyCount, prefix,  altPrefix);
+            generateTestCase(coll, monkeys, monkeyCount, suffix,  altSuffix);
+            
+            if (!isICUVersionAtLeast(icu47) && skipSet->containsSome(pattern)) {
+                continue; // timebomb until ticket #8080 is resolved
+            }
+
+            BoyerMooreSearch pat(data, pattern, NULL, status);
+            BoyerMooreSearch alt(data, altPattern, NULL, status);
+
+            // **** need a better way to deal with this ****
+#if 0
+            if (pat.empty() ||
+                alt.empty()) {
+                    continue;
+            }
+#endif
+
+            // pattern
+            notFoundCount += bmMonkeyTestCase(coll, pattern, pattern, altPattern, &pat, &alt, "pattern", strengthNames[s], seed);
+
+            testCase.remove();
+            testCase.append(prefix);
+            testCase.append(/*alt*/pattern);
+
+            // prefix + pattern
+            notFoundCount += bmMonkeyTestCase(coll, testCase, pattern, altPattern, &pat, &alt, "prefix + pattern", strengthNames[s], seed);
+
+            testCase.append(suffix);
+
+            // prefix + pattern + suffix
+            notFoundCount += bmMonkeyTestCase(coll, testCase, pattern, altPattern, &pat, &alt, "prefix + pattern + suffix", strengthNames[s], seed);
+
+            testCase.remove();
+            testCase.append(pattern);
+            testCase.append(suffix);
+
+            // pattern + suffix
+            notFoundCount += bmMonkeyTestCase(coll, testCase, pattern, altPattern, &pat, &alt, "pattern + suffix", strengthNames[s], seed);
+        }
+        delete skipSet; // for timebomb
+
+        CollData::close(data);
+
+        logln("For strength %s the not found count is %d.", strengthNames[s], notFoundCount);
+    }
+
+    uset_close(contractions);
+    uset_close(expansions);
+    uset_close(letters);
+
+    CollData::close(monkeyData);
+
+    ucol_close(coll);
+}
+
+void SSearchTest::stringListTest(){
+    UErrorCode status = U_ZERO_ERROR;
+    StringList *sl = new StringList(status);
+    if(U_FAILURE(status)){
+        errln("ERROR: stringListTest: Could not start StringList");
+    }
+
+    const UChar chars[] = {
+            0x0000
+    };
+    sl->add(chars, (int32_t) 0, status);
+    if(U_FAILURE(status)){
+        errln("ERROR: stringListTest: StringList::add");
+    }
+
+    if(sl->getDynamicClassID() != StringList::getStaticClassID()){
+        errln("ERROR: stringListTest: getDynamicClassID and getStaticClassID does not match");
+    }
+    delete sl;
+}
+
+#endif
+
+#endif