Chromium Code Reviews
chromiumcodereview-hr@appspot.gserviceaccount.com (chromiumcodereview-hr) | Please choose your nickname with Settings | Help | Chromium Project | Gerrit Changes | Sign out
(4912)

Unified Diff: chrome/test/data/dromaeo/tests/sunspider-string-fasta.html

Issue 269054: Importing dromaeo performance tests to src/chrome/test/data.... (Closed) Base URL: svn://chrome-svn/chrome/trunk/src/
Patch Set: Created 11 years, 2 months ago
Use n/p to move between diff chunks; N/P to move between comments. Draft comments are only viewable by you.
Jump to:
View side-by-side diff with in-line comments
Download patch
Index: chrome/test/data/dromaeo/tests/sunspider-string-fasta.html
===================================================================
--- chrome/test/data/dromaeo/tests/sunspider-string-fasta.html (revision 0)
+++ chrome/test/data/dromaeo/tests/sunspider-string-fasta.html (revision 0)
@@ -0,0 +1,104 @@
+<html>
+<head>
+<script src="../htmlrunner.js"></script>
+<script>
+// The Great Computer Language Shootout
+// http://shootout.alioth.debian.org
+//
+// Contributed by Ian Osgood
+
+var last = 42, A = 3877, C = 29573, M = 139968;
+
+function rand(max) {
+ last = (last * A + C) % M;
+ return max * last / M;
+}
+
+var ALU =
+ "GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
+ "GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
+ "CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
+ "ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
+ "GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
+ "AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
+ "AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA";
+
+var IUB = {
+ a:0.27, c:0.12, g:0.12, t:0.27,
+ B:0.02, D:0.02, H:0.02, K:0.02,
+ M:0.02, N:0.02, R:0.02, S:0.02,
+ V:0.02, W:0.02, Y:0.02
+}
+
+var HomoSap = {
+ a: 0.3029549426680,
+ c: 0.1979883004921,
+ g: 0.1975473066391,
+ t: 0.3015094502008
+}
+
+function makeCumulative(table) {
+ var last = null;
+ for (var c in table) {
+ if (last) table[c] += table[last];
+ last = c;
+ }
+}
+
+function fastaRepeat(n, seq) {
+ var seqi = 0, lenOut = 60;
+ while (n>0) {
+ if (n<lenOut) lenOut = n;
+ if (seqi + lenOut < seq.length) {
+ ret = seq.substring(seqi, seqi+lenOut);
+ seqi += lenOut;
+ } else {
+ var s = seq.substring(seqi);
+ seqi = lenOut - s.length;
+ ret = s + seq.substring(0, seqi);
+ }
+ n -= lenOut;
+ }
+}
+
+function fastaRandom(n, table) {
+ var line = new Array(60);
+ makeCumulative(table);
+ while (n>0) {
+ if (n<line.length) line = new Array(n);
+ for (var i=0; i<line.length; i++) {
+ var r = rand(1);
+ for (var c in table) {
+ if (r < table[c]) {
+ line[i] = c;
+ break;
+ }
+ }
+ }
+ ret = line.join('');
+ n -= line.length;
+ }
+}
+
+window.onload = function(){ startTest("sunspider-string-fasta", '');
+
+var ret;
+var n = 16;
+
+test( "Homo sapiens alu", function(){
+ ret = fastaRepeat(4*n*10000, ALU);
+});
+
+test( "IUB ambiguity codes", function(){
+ ret = fastaRandom(3*n*100, IUB);
+});
+
+test( "Homo sapiens frequency", function(){
+ ret = fastaRandom(5*n*100, HomoSap);
+});
+
+endTest(); };
+</script>
+</head>
+<body></body>
+</html>

Powered by Google App Engine
This is Rietveld 408576698