source/test/intltest/ssearch.cpp - Issue 2435373002: Delete source/test

Unified Diff: source/test/intltest/ssearch.cpp

Issue 2435373002: Delete source/test (Closed)

Patch Set: Created 4 years, 2 months ago

Use n/p to move between diff chunks; N/P to move between comments. Draft comments are only viewable by you.

Jump to:

View side-by-side diff with in-line comments

Index: source/test/intltest/ssearch.cpp

diff --git a/source/test/intltest/ssearch.cpp b/source/test/intltest/ssearch.cpp

deleted file mode 100644

index 1c78370bb275e4322c924ef1414961bf5039eb31..0000000000000000000000000000000000000000

--- a/source/test/intltest/ssearch.cpp

+++ /dev/null

@@ -1,1494 +0,0 @@

-/*

- **********************************************************************

- */

-#include "unicode/utypes.h"

-#if !UCONFIG_NO_COLLATION

-#include "cmemory.h"

-#include "cstring.h"

-#include "usrchimp.h"

-#include "unicode/coll.h"

-#include "unicode/tblcoll.h"

-#include "unicode/usearch.h"

-#include "unicode/uset.h"

-#include "unicode/ustring.h"

-#include "unicode/coleitr.h"

-#include "unicode/regex.h" // TODO: make conditional on regexp being built.

-#include "colldata.h"

-#include "ssearch.h"

-#include "xmlparser.h"

-#include <stdio.h> // for sprintf

-char testId[100];

-#define TEST_ASSERT(x) {if (!(x)) { \

- errln("Failure in file %s, line %d, test ID = \"%s\"", __FILE__, __LINE__, testId);}}

-#define TEST_ASSERT_M(x, m) {if (!(x)) { \

- dataerrln("Failure in file %s, line %d. \"%s\"", __FILE__, __LINE__, m);return;}}

-#define TEST_ASSERT_SUCCESS(errcode) {if (U_FAILURE(errcode)) { \

- dataerrln("Failure in file %s, line %d, test ID \"%s\", status = \"%s\"", \

- __FILE__, __LINE__, testId, u_errorName(errcode));}}

-#define ARRAY_SIZE(array) (sizeof array / sizeof array[0])

-#define NEW_ARRAY(type, count) (type *) uprv_malloc((count) * sizeof(type))

-#define DELETE_ARRAY(array) uprv_free((void *) (array))

-//---------------------------------------------------------------------------

-//

-// Test class boilerplate

-//

-//---------------------------------------------------------------------------

-SSearchTest::SSearchTest()

-SSearchTest::~SSearchTest()

-void SSearchTest::runIndexedTest( int32_t index, UBool exec, const char* &name, char *params )

- if (exec) logln("TestSuite SSearchTest: ");

- switch (index) {

-#if !UCONFIG_NO_BREAK_ITERATION

- case 0: name = "searchTest";

- if (exec) searchTest();

- break;

- case 1: name = "offsetTest";

- if (exec) offsetTest();

- break;

- case 2: name = "monkeyTest";

- if (exec) monkeyTest(params);

- break;

- case 3: name = "sharpSTest";

- if (exec) sharpSTest();

- break;

- case 4: name = "goodSuffixTest";

- if (exec) goodSuffixTest();

- break;

- case 5: name = "searchTime";

- if (exec) searchTime();

- break;

-#endif

- default: name = "";

- break; //needed to end loop

- }

-#if !UCONFIG_NO_BREAK_ITERATION

-#define PATH_BUFFER_SIZE 2048

-const char *SSearchTest::getPath(char buffer[2048], const char *filename) {

- UErrorCode status = U_ZERO_ERROR;

- const char *testDataDirectory = IntlTest::getSourceTestData(status);

- if (U_FAILURE(status) || strlen(testDataDirectory) + strlen(filename) + 1 >= PATH_BUFFER_SIZE) {

- errln("ERROR: getPath() failed - %s", u_errorName(status));

- return NULL;

- }

- strcpy(buffer, testDataDirectory);

- strcat(buffer, filename);

- return buffer;

-void SSearchTest::searchTest()

-#if !UCONFIG_NO_REGULAR_EXPRESSIONS && !UCONFIG_NO_FILE_IO

- UErrorCode status = U_ZERO_ERROR;

- char path[PATH_BUFFER_SIZE];

- const char *testFilePath = getPath(path, "ssearch.xml");

- if (testFilePath == NULL) {

- return; /* Couldn't get path: error message already output. */

- }

- LocalPointer<UXMLParser> parser(UXMLParser::createParser(status));

- TEST_ASSERT_SUCCESS(status);

- LocalPointer<UXMLElement> root(parser->parseFile(testFilePath, status));

- TEST_ASSERT_SUCCESS(status);

- if (U_FAILURE(status)) {

- return;

- }

- const UnicodeString *debugTestCase = root->getAttribute("debug");

- if (debugTestCase != NULL) {

-// setenv("USEARCH_DEBUG", "1", 1);

- }

- const UXMLElement *testCase;

- int32_t tc = 0;

- while((testCase = root->nextChildElement(tc)) != NULL) {

- if (testCase->getTagName().compare("test-case") != 0) {

- errln("ssearch, unrecognized XML Element in test file");

- continue;

- }

- const UnicodeString *id = testCase->getAttribute("id");

- *testId = 0;

- if (id != NULL) {

- id->extract(0, id->length(), testId, sizeof(testId), US_INV);

- }

- // If debugging test case has been specified and this is not it, skip to next.

- if (id!=NULL && debugTestCase!=NULL && *id != *debugTestCase) {

- continue;

- }

- //

- // Get the requested collation strength.

- // Default is tertiary if the XML attribute is missing from the test case.

- //

- const UnicodeString *strength = testCase->getAttribute("strength");

- UColAttributeValue collatorStrength = UCOL_PRIMARY;

- if (strength==NULL) { collatorStrength = UCOL_TERTIARY;}

- else if (*strength=="PRIMARY") { collatorStrength = UCOL_PRIMARY;}

- else if (*strength=="SECONDARY") { collatorStrength = UCOL_SECONDARY;}

- else if (*strength=="TERTIARY") { collatorStrength = UCOL_TERTIARY;}

- else if (*strength=="QUATERNARY") { collatorStrength = UCOL_QUATERNARY;}

- else if (*strength=="IDENTICAL") { collatorStrength = UCOL_IDENTICAL;}

- else {

- // Bogus value supplied for strength. Shouldn't happen, even from

- // typos, if the XML source has been validated.

- // This assert is a little deceiving in that strength can be

- // any of the allowed values, not just TERTIARY, but it will

- // do the job of getting the error output.

- TEST_ASSERT(*strength=="TERTIARY")

- }

- //

- // Get the collator normalization flag. Default is UCOL_OFF.

- //

- UColAttributeValue normalize = UCOL_OFF;

- const UnicodeString *norm = testCase->getAttribute("norm");

- TEST_ASSERT (norm==NULL || *norm=="ON" || *norm=="OFF");

- if (norm!=NULL && *norm=="ON") {

- normalize = UCOL_ON;

- }

- //

- // Get the alternate_handling flag. Default is UCOL_NON_IGNORABLE.

- //

- UColAttributeValue alternateHandling = UCOL_NON_IGNORABLE;

- const UnicodeString *alt = testCase->getAttribute("alternate_handling");

- TEST_ASSERT (alt == NULL || *alt == "SHIFTED" || *alt == "NON_IGNORABLE");

- if (alt != NULL && *alt == "SHIFTED") {

- alternateHandling = UCOL_SHIFTED;

- }

- const UnicodeString defLocale("en");

- char clocale[100];

- const UnicodeString *locale = testCase->getAttribute("locale");

- if (locale == NULL || locale->length()==0) {

- locale = &defLocale;

- };

- locale->extract(0, locale->length(), clocale, sizeof(clocale), NULL);

- UnicodeString text;

- UnicodeString target;

- UnicodeString pattern;

- int32_t expectedMatchStart = -1;

- int32_t expectedMatchLimit = -1;

- const UXMLElement *n;

- int32_t nodeCount = 0;

- n = testCase->getChildElement("pattern");

- TEST_ASSERT(n != NULL);

- if (n==NULL) {

- continue;

- }

- text = n->getText(FALSE);

- text = text.unescape();

- pattern.append(text);

- nodeCount++;

- n = testCase->getChildElement("pre");

- if (n!=NULL) {

- text = n->getText(FALSE);

- text = text.unescape();

- target.append(text);

- nodeCount++;

- }

- n = testCase->getChildElement("m");

- if (n!=NULL) {

- expectedMatchStart = target.length();

- text = n->getText(FALSE);

- text = text.unescape();

- target.append(text);

- expectedMatchLimit = target.length();

- nodeCount++;

- }

- n = testCase->getChildElement("post");

- if (n!=NULL) {

- text = n->getText(FALSE);

- text = text.unescape();

- target.append(text);

- nodeCount++;

- }

- // Check that there weren't extra things in the XML

- TEST_ASSERT(nodeCount == testCase->countChildren());

- // Open a collator and StringSearch based on the parameters

- // obtained from the XML.

- //

- status = U_ZERO_ERROR;

- LocalUCollatorPointer collator(ucol_open(clocale, &status));

- ucol_setStrength(collator.getAlias(), collatorStrength);

- ucol_setAttribute(collator.getAlias(), UCOL_NORMALIZATION_MODE, normalize, &status);

- ucol_setAttribute(collator.getAlias(), UCOL_ALTERNATE_HANDLING, alternateHandling, &status);

- LocalUStringSearchPointer uss(usearch_openFromCollator(pattern.getBuffer(), pattern.length(),

- target.getBuffer(), target.length(),

- collator.getAlias(),

- NULL, // the break iterator

- &status));

- TEST_ASSERT_SUCCESS(status);

- if (U_FAILURE(status)) {

- continue;

- }

- int32_t foundStart = 0;

- int32_t foundLimit = 0;

- UBool foundMatch;

- //

- // Do the search, check the match result against the expected results.

- //

- foundMatch= usearch_search(uss.getAlias(), 0, &foundStart, &foundLimit, &status);

- TEST_ASSERT_SUCCESS(status);

- if ((foundMatch && expectedMatchStart<0) ||

- (foundStart != expectedMatchStart) ||

- (foundLimit != expectedMatchLimit)) {

- TEST_ASSERT(FALSE); // ouput generic error position

- infoln("Found, expected match start = %d, %d \n"

- "Found, expected match limit = %d, %d",

- foundStart, expectedMatchStart, foundLimit, expectedMatchLimit);

- }

- // In case there are other matches...

- // (should we only do this if the test case passed?)

- while (foundMatch) {

- expectedMatchStart = foundStart;

- expectedMatchLimit = foundLimit;

- foundMatch = usearch_search(uss.getAlias(), foundLimit, &foundStart, &foundLimit, &status);

- }

- uss.adoptInstead(usearch_openFromCollator(pattern.getBuffer(), pattern.length(),

- target.getBuffer(), target.length(),

- collator.getAlias(),

- NULL,

- &status));

- //

- // Do the backwards search, check the match result against the expected results.

- //

- foundMatch= usearch_searchBackwards(uss.getAlias(), target.length(), &foundStart, &foundLimit, &status);

- TEST_ASSERT_SUCCESS(status);

- if ((foundMatch && expectedMatchStart<0) ||

- (foundStart != expectedMatchStart) ||

- (foundLimit != expectedMatchLimit)) {

- TEST_ASSERT(FALSE); // ouput generic error position

- infoln("Found, expected backwards match start = %d, %d \n"

- "Found, expected backwards match limit = %d, %d",

- foundStart, expectedMatchStart, foundLimit, expectedMatchLimit);

- }

-#endif

-struct Order

- int32_t order;

- int32_t lowOffset;

- int32_t highOffset;

-};

-class OrderList

-public:

- OrderList();

- OrderList(UCollator *coll, const UnicodeString &string, int32_t stringOffset = 0);

- ~OrderList();

- int32_t size(void) const;

- void add(int32_t order, int32_t low, int32_t high);

- const Order *get(int32_t index) const;

- int32_t getLowOffset(int32_t index) const;

- int32_t getHighOffset(int32_t index) const;

- int32_t getOrder(int32_t index) const;

- void reverse(void);

- UBool compare(const OrderList &other) const;

- UBool matchesAt(int32_t offset, const OrderList &other) const;

-private:

- Order *list;

- int32_t listMax;

- int32_t listSize;

-};

-OrderList::OrderList()

- : list(NULL), listMax(16), listSize(0)

- list = new Order[listMax];

-OrderList::OrderList(UCollator *coll, const UnicodeString &string, int32_t stringOffset)

- : list(NULL), listMax(16), listSize(0)

- UErrorCode status = U_ZERO_ERROR;

- UCollationElements *elems = ucol_openElements(coll, string.getBuffer(), string.length(), &status);

- uint32_t strengthMask = 0;

- int32_t order, low, high;

- switch (ucol_getStrength(coll))

- {

- default:

- strengthMask |= UCOL_TERTIARYORDERMASK;

- /* fall through */

- case UCOL_SECONDARY:

- strengthMask |= UCOL_SECONDARYORDERMASK;

- /* fall through */

- case UCOL_PRIMARY:

- strengthMask |= UCOL_PRIMARYORDERMASK;

- }

- list = new Order[listMax];

- ucol_setOffset(elems, stringOffset, &status);

- do {

- low = ucol_getOffset(elems);

- order = ucol_next(elems, &status);

- high = ucol_getOffset(elems);

- if (order != UCOL_NULLORDER) {

- order &= strengthMask;

- }

- if (order != UCOL_IGNORABLE) {

- add(order, low, high);

- }

- } while (order != UCOL_NULLORDER);

- ucol_closeElements(elems);

-OrderList::~OrderList()

- delete[] list;

-void OrderList::add(int32_t order, int32_t low, int32_t high)

- if (listSize >= listMax) {

- listMax *= 2;

- Order *newList = new Order[listMax];

- uprv_memcpy(newList, list, listSize * sizeof(Order));

- delete[] list;

- list = newList;

- }

- list[listSize].order = order;

- list[listSize].lowOffset = low;

- list[listSize].highOffset = high;

- listSize += 1;

-const Order *OrderList::get(int32_t index) const

- if (index >= listSize) {

- return NULL;

- }

- return &list[index];

-int32_t OrderList::getLowOffset(int32_t index) const

- const Order *order = get(index);

- if (order != NULL) {

- return order->lowOffset;

- }

- return -1;

-int32_t OrderList::getHighOffset(int32_t index) const

- const Order *order = get(index);

- if (order != NULL) {

- return order->highOffset;

- }

- return -1;

-int32_t OrderList::getOrder(int32_t index) const

- const Order *order = get(index);

- if (order != NULL) {

- return order->order;

- }

- return UCOL_NULLORDER;

-int32_t OrderList::size() const

- return listSize;

-void OrderList::reverse()

- for(int32_t f = 0, b = listSize - 1; f < b; f += 1, b -= 1) {

- Order swap = list[b];

- list[b] = list[f];

- list[f] = swap;

- }

-UBool OrderList::compare(const OrderList &other) const

- if (listSize != other.listSize) {

- return FALSE;

- }

- for(int32_t i = 0; i < listSize; i += 1) {

- if (list[i].order != other.list[i].order ||

- list[i].lowOffset != other.list[i].lowOffset ||

- list[i].highOffset != other.list[i].highOffset) {

- return FALSE;

- }

- return TRUE;

-UBool OrderList::matchesAt(int32_t offset, const OrderList &other) const

- // NOTE: sizes include the NULLORDER, which we don't want to compare.

- int32_t otherSize = other.size() - 1;

- if (listSize - 1 - offset < otherSize) {

- return FALSE;

- }

- for (int32_t i = offset, j = 0; j < otherSize; i += 1, j += 1) {

- if (getOrder(i) != other.getOrder(j)) {

- return FALSE;

- }

- return TRUE;

-static char *printOffsets(char *buffer, OrderList &list)

- int32_t size = list.size();

- char *s = buffer;

- for(int32_t i = 0; i < size; i += 1) {

- const Order *order = list.get(i);

- if (i != 0) {

- s += sprintf(s, ", ");

- }

- s += sprintf(s, "(%d, %d)", order->lowOffset, order->highOffset);

- }

- return buffer;

-static char *printOrders(char *buffer, OrderList &list)

- int32_t size = list.size();

- char *s = buffer;

- for(int32_t i = 0; i < size; i += 1) {

- const Order *order = list.get(i);

- if (i != 0) {

- s += sprintf(s, ", ");

- }

- s += sprintf(s, "%8.8X", order->order);

- }

- return buffer;

-void SSearchTest::offsetTest()

- const char *test[] = {

- // The sequence \u0FB3\u0F71\u0F71\u0F80 contains a discontiguous

- // contraction (\u0FB3\u0F71\u0F80) logically followed by \u0F71.

- "\\u1E33\\u0FB3\\u0F71\\u0F71\\u0F80\\uD835\\uDF6C\\u01B0",

- "\\ua191\\u16ef\\u2036\\u017a",

-#if 0

- // This results in a complex interaction between contraction,

- // expansion and normalization that confuses the backwards offset fixups.

- "\\u0F7F\\u0F80\\u0F81\\u0F82\\u0F83\\u0F84\\u0F85",

-#endif

- "\\u0F80\\u0F81\\u0F82\\u0F83\\u0F84\\u0F85",

- "\\u07E9\\u07EA\\u07F1\\u07F2\\u07F3",

- "\\u02FE\\u02FF"

- "\\u0300\\u0301\\u0302\\u0303\\u0304\\u0305\\u0306\\u0307\\u0308\\u0309\\u030A\\u030B\\u030C\\u030D\\u030E\\u030F"

- "\\u0310\\u0311\\u0312\\u0313\\u0314\\u0315\\u0316\\u0317\\u0318\\u0319\\u031A\\u031B\\u031C\\u031D\\u031E\\u031F"

- "\\u0320\\u0321\\u0322\\u0323\\u0324\\u0325\\u0326\\u0327\\u0328\\u0329\\u032A\\u032B\\u032C\\u032D\\u032E\\u032F"

- "\\u0330\\u0331\\u0332\\u0333\\u0334\\u0335\\u0336\\u0337\\u0338\\u0339\\u033A\\u033B\\u033C\\u033D\\u033E\\u033F"

- "\\u0340\\u0341\\u0342\\u0343\\u0344\\u0345\\u0346\\u0347\\u0348\\u0349\\u034A\\u034B\\u034C\\u034D\\u034E", // currently not working, see #8081

- "\\u02FE\\u02FF\\u0300\\u0301\\u0302\\u0303\\u0316\\u0317\\u0318", // currently not working, see #8081

- "a\\u02FF\\u0301\\u0316", // currently not working, see #8081

- "a\\u02FF\\u0316\\u0301",

- "a\\u0430\\u0301\\u0316",

- "a\\u0430\\u0316\\u0301",

- "abc\\u0E41\\u0301\\u0316",

- "abc\\u0E41\\u0316\\u0301",

- "\\u0E41\\u0301\\u0316",

- "\\u0E41\\u0316\\u0301",

- "a\\u0301\\u0316",

- "a\\u0316\\u0301",

- "\\uAC52\\uAC53",

- "\\u34CA\\u34CB",

- "\\u11ED\\u11EE",

- "\\u30C3\\u30D0",

- "p\\u00E9ch\\u00E9",

- "a\\u0301\\u0325",

- "a\\u0300\\u0325",

- "a\\u0325\\u0300",

- "A\\u0323\\u0300B",

- "A\\u0300\\u0323B",

- "A\\u0301\\u0323B",

- "A\\u0302\\u0301\\u0323B",

- "abc",

- "ab\\u0300c",

- "ab\\u0300\\u0323c",

- " \\uD800\\uDC00\\uDC00",

- "a\\uD800\\uDC00\\uDC00",

- "A\\u0301\\u0301",

- "A\\u0301\\u0323",

- "A\\u0301\\u0323B",

- "B\\u0301\\u0323C",

- "A\\u0300\\u0323B",

- "\\u0301A\\u0301\\u0301",

- "abcd\\r\\u0301",

- "p\\u00EAche",

- "pe\\u0302che",

- };

- int32_t testCount = ARRAY_SIZE(test);

- UErrorCode status = U_ZERO_ERROR;

- RuleBasedCollator *col = (RuleBasedCollator *) Collator::createInstance(Locale::getEnglish(), status);

- if (U_FAILURE(status)) {

- errcheckln(status, "Failed to create collator in offsetTest! - %s", u_errorName(status));

- return;

- }

- char buffer[4096]; // A bit of a hack... just happens to be long enough for all the test cases...

- // We could allocate one that's the right size by (CE_count * 10) + 2

- // 10 chars is enough room for 8 hex digits plus ", ". 2 extra chars for "[" and "]"

- col->setAttribute(UCOL_NORMALIZATION_MODE, UCOL_ON, status);

- for(int32_t i = 0; i < testCount; i += 1) {

- UnicodeString ts = CharsToUnicodeString(test[i]);

- CollationElementIterator *iter = col->createCollationElementIterator(ts);

- OrderList forwardList;

- OrderList backwardList;

- int32_t order, low, high;

- do {

- low = iter->getOffset();

- order = iter->next(status);

- high = iter->getOffset();

- forwardList.add(order, low, high);

- } while (order != CollationElementIterator::NULLORDER);

- iter->reset();

- iter->setOffset(ts.length(), status);

- backwardList.add(CollationElementIterator::NULLORDER, iter->getOffset(), iter->getOffset());

- do {

- high = iter->getOffset();

- order = iter->previous(status);

- low = iter->getOffset();

- if (order == CollationElementIterator::NULLORDER) {

- break;

- }

- backwardList.add(order, low, high);

- } while (TRUE);

- backwardList.reverse();

- if (forwardList.compare(backwardList)) {

- logln("Works with \"%s\"", test[i]);

- logln("Forward offsets: [%s]", printOffsets(buffer, forwardList));

-// logln("Backward offsets: [%s]", printOffsets(buffer, backwardList));

- logln("Forward CEs: [%s]", printOrders(buffer, forwardList));

-// logln("Backward CEs: [%s]", printOrders(buffer, backwardList));

- logln();

- } else {

- errln("Fails with \"%s\"", test[i]);

- infoln("Forward offsets: [%s]", printOffsets(buffer, forwardList));

- infoln("Backward offsets: [%s]", printOffsets(buffer, backwardList));

- infoln("Forward CEs: [%s]", printOrders(buffer, forwardList));

- infoln("Backward CEs: [%s]", printOrders(buffer, backwardList));

- infoln();

- }

- delete iter;

- }

- delete col;

-#if 0

-static UnicodeString &escape(const UnicodeString &string, UnicodeString &buffer)

- for(int32_t i = 0; i < string.length(); i += 1) {

- UChar32 ch = string.char32At(i);

- if (ch >= 0x0020 && ch <= 0x007F) {

- if (ch == 0x005C) {

- buffer.append("\\\\");

- } else {

- buffer.append(ch);

- }

- } else {

- char cbuffer[12];

- if (ch <= 0xFFFFL) {

- sprintf(cbuffer, "\\u%4.4X", ch);

- } else {

- sprintf(cbuffer, "\\U%8.8X", ch);

- }

- buffer.append(cbuffer);

- }

- if (ch >= 0x10000L) {

- i += 1;

- }

- return buffer;

-#endif

-void SSearchTest::sharpSTest()

- UErrorCode status = U_ZERO_ERROR;

- UCollator *coll = NULL;

- UnicodeString lp = "fuss";

- UnicodeString sp = "fu\\u00DF";

- UnicodeString targets[] = {"fu\\u00DF", "fu\\u00DFball", "1fu\\u00DFball", "12fu\\u00DFball", "123fu\\u00DFball", "1234fu\\u00DFball",

- "ffu\\u00DF", "fufu\\u00DF", "fusfu\\u00DF",

- "fuss", "ffuss", "fufuss", "fusfuss", "1fuss", "12fuss", "123fuss", "1234fuss", "fu\\u00DF", "1fu\\u00DF", "12fu\\u00DF", "123fu\\u00DF", "1234fu\\u00DF"};

- int32_t start = -1, end = -1;

- coll = ucol_openFromShortString("LEN_S1", FALSE, NULL, &status);

- TEST_ASSERT_SUCCESS(status);

- UnicodeString lpUnescaped = lp.unescape();

- UnicodeString spUnescaped = sp.unescape();

- LocalUStringSearchPointer ussLong(usearch_openFromCollator(lpUnescaped.getBuffer(), lpUnescaped.length(),

- lpUnescaped.getBuffer(), lpUnescaped.length(), // actual test data will be set later

- coll,

- NULL, // the break iterator

- &status));

- LocalUStringSearchPointer ussShort(usearch_openFromCollator(spUnescaped.getBuffer(), spUnescaped.length(),

- spUnescaped.getBuffer(), spUnescaped.length(), // actual test data will be set later

- coll,

- NULL, // the break iterator

- &status));

- TEST_ASSERT_SUCCESS(status);

- for (uint32_t t = 0; t < (sizeof(targets)/sizeof(targets[0])); t += 1) {

- UBool bFound;

- UnicodeString target = targets[t].unescape();

- start = end = -1;

- usearch_setText(ussLong.getAlias(), target.getBuffer(), target.length(), &status);

- bFound = usearch_search(ussLong.getAlias(), 0, &start, &end, &status);

- TEST_ASSERT_SUCCESS(status);

- if (bFound) {

- logln("Test %d: found long pattern at [%d, %d].", t, start, end);

- } else {

- dataerrln("Test %d: did not find long pattern.", t);

- }

- usearch_setText(ussShort.getAlias(), target.getBuffer(), target.length(), &status);

- bFound = usearch_search(ussShort.getAlias(), 0, &start, &end, &status);

- TEST_ASSERT_SUCCESS(status);

- if (bFound) {

- logln("Test %d: found long pattern at [%d, %d].", t, start, end);

- } else {

- dataerrln("Test %d: did not find long pattern.", t);

- }

- ucol_close(coll);

-void SSearchTest::goodSuffixTest()

- UErrorCode status = U_ZERO_ERROR;

- UCollator *coll = NULL;

- UnicodeString pat = /*"gcagagag"*/ "fxeld";

- UnicodeString target = /*"gcatcgcagagagtatacagtacg"*/ "cloveldfxeld";

- int32_t start = -1, end = -1;

- UBool bFound;

- coll = ucol_open(NULL, &status);

- TEST_ASSERT_SUCCESS(status);

- LocalUStringSearchPointer ss(usearch_openFromCollator(pat.getBuffer(), pat.length(),

- target.getBuffer(), target.length(),

- coll,

- NULL, // the break iterator

- &status));

- TEST_ASSERT_SUCCESS(status);

- bFound = usearch_search(ss.getAlias(), 0, &start, &end, &status);

- TEST_ASSERT_SUCCESS(status);

- if (bFound) {

- logln("Found pattern at [%d, %d].", start, end);

- } else {

- dataerrln("Did not find pattern.");

- }

- ucol_close(coll);

-//

-// searchTime() A quick and dirty performance test for string search.

-// Probably doesn't really belong as part of intltest, but it

-// does check that the search succeeds, and gets the right result,

-// so it serves as a functionality test also.

-//

-// To run as a perf test, up the loop count, select by commenting

-// and uncommenting in the code the operation to be measured,

-// rebuild, and measure the running time of this test alone.

-//

-// time LD_LIBRARY_PATH=whatever ./intltest collate/SSearchTest/searchTime

-//

-void SSearchTest::searchTime() {

- static const char *longishText =

-"Whylom, as olde stories tellen us,\n"

-"Ther was a duk that highte Theseus:\n"

-"Of Athenes he was lord and governour,\n"

-"And in his tyme swich a conquerour,\n"

-"That gretter was ther noon under the sonne.\n"

-"Ful many a riche contree hadde he wonne;\n"

-"What with his wisdom and his chivalrye,\n"

-"He conquered al the regne of Femenye,\n"

-"That whylom was y-cleped Scithia;\n"

-"And weddede the quene Ipolita,\n"

-"And broghte hir hoom with him in his contree\n"

-"With muchel glorie and greet solempnitee,\n"

-"And eek hir yonge suster Emelye.\n"

-"And thus with victorie and with melodye\n"

-"Lete I this noble duk to Athenes ryde,\n"

-"And al his hoost, in armes, him bisyde.\n"

-"And certes, if it nere to long to here,\n"

-"I wolde han told yow fully the manere,\n"

-"How wonnen was the regne of Femenye\n"

-"By Theseus, and by his chivalrye;\n"

-"And of the grete bataille for the nones\n"

-"Bitwixen Athen's and Amazones;\n"

-"And how asseged was Ipolita,\n"

-"The faire hardy quene of Scithia;\n"

-"And of the feste that was at hir weddinge,\n"

-"And of the tempest at hir hoom-cominge;\n"

-"But al that thing I moot as now forbere.\n"

-"I have, God woot, a large feeld to ere,\n"

-"And wayke been the oxen in my plough.\n"

-"The remenant of the tale is long y-nough.\n"

-"I wol nat letten eek noon of this route;\n"

-"Lat every felawe telle his tale aboute,\n"

-"And lat see now who shal the soper winne;\n"

-"And ther I lefte, I wol ageyn biginne.\n"

-"This duk, of whom I make mencioun,\n"

-"When he was come almost unto the toun,\n"

-"In al his wele and in his moste pryde,\n"

-"He was war, as he caste his eye asyde,\n"

-"Wher that ther kneled in the hye weye\n"

-"A companye of ladies, tweye and tweye,\n"

-"Ech after other, clad in clothes blake; \n"

-"But swich a cry and swich a wo they make,\n"

-"That in this world nis creature livinge,\n"

-"That herde swich another weymentinge;\n"

-"And of this cry they nolde never stenten,\n"

-"Til they the reynes of his brydel henten.\n"

-"'What folk ben ye, that at myn hoomcominge\n"

-"Perturben so my feste with cryinge'?\n"

-"Quod Theseus, 'have ye so greet envye\n"

-"Of myn honour, that thus compleyne and crye? \n"

-"Or who hath yow misboden, or offended?\n"

-"And telleth me if it may been amended;\n"

-"And why that ye ben clothed thus in blak'?\n"

-"The eldest lady of hem alle spak,\n"

-"When she hadde swowned with a deedly chere,\n"

-"That it was routhe for to seen and here,\n"

-"And seyde: 'Lord, to whom Fortune hath yiven\n"

-"Victorie, and as a conquerour to liven,\n"

-"Noght greveth us your glorie and your honour;\n"

-"But we biseken mercy and socour.\n"

-"Have mercy on our wo and our distresse.\n"

-"Som drope of pitee, thurgh thy gentilesse,\n"

-"Up-on us wrecched wommen lat thou falle.\n"

-"For certes, lord, ther nis noon of us alle,\n"

-"That she nath been a duchesse or a quene;\n"

-"Now be we caitifs, as it is wel sene:\n"

-"Thanked be Fortune, and hir false wheel,\n"

-"That noon estat assureth to be weel.\n"

-"And certes, lord, t'abyden your presence,\n"

-"Here in the temple of the goddesse Clemence\n"

-"We han ben waytinge al this fourtenight;\n"

-"Now help us, lord, sith it is in thy might.\n"

-"I wrecche, which that wepe and waille thus,\n"

-"Was whylom wyf to king Capaneus,\n"

-"That starf at Thebes, cursed be that day!\n"

-"And alle we, that been in this array,\n"

-"And maken al this lamentacioun,\n"

-"We losten alle our housbondes at that toun,\n"

-"Whyl that the sege ther-aboute lay.\n"

-"And yet now th'olde Creon, weylaway!\n"

-"The lord is now of Thebes the citee, \n"

-"Fulfild of ire and of iniquitee,\n"

-"He, for despyt, and for his tirannye,\n"

-"To do the dede bodyes vileinye,\n"

-"Of alle our lordes, whiche that ben slawe,\n"

-"Hath alle the bodyes on an heep y-drawe,\n"

-"And wol nat suffren hem, by noon assent,\n"

-"Neither to been y-buried nor y-brent,\n"

-"But maketh houndes ete hem in despyt. zet'\n";

-const char *cPattern = "maketh houndes ete hem";

-//const char *cPattern = "Whylom";

-//const char *cPattern = "zet";

- const char *testId = "searchTime()"; // for error macros.

- UnicodeString target = longishText;

- UErrorCode status = U_ZERO_ERROR;

- LocalUCollatorPointer collator(ucol_open("en", &status));

- //ucol_setStrength(collator.getAlias(), collatorStrength);

- //ucol_setAttribute(collator.getAlias(), UCOL_NORMALIZATION_MODE, normalize, &status);

- UnicodeString uPattern = cPattern;

- LocalUStringSearchPointer uss(usearch_openFromCollator(uPattern.getBuffer(), uPattern.length(),

- target.getBuffer(), target.length(),

- collator.getAlias(),

- NULL, // the break iterator

- &status));

- TEST_ASSERT_SUCCESS(status);

-// int32_t foundStart;

-// int32_t foundEnd;

- UBool found;

- // Find the match position usgin strstr

- const char *pm = strstr(longishText, cPattern);

- TEST_ASSERT_M(pm!=NULL, "No pattern match with strstr");

- int32_t refMatchPos = (int32_t)(pm - longishText);

- int32_t icuMatchPos;

- int32_t icuMatchEnd;

- usearch_search(uss.getAlias(), 0, &icuMatchPos, &icuMatchEnd, &status);

- TEST_ASSERT_SUCCESS(status);

- TEST_ASSERT_M(refMatchPos == icuMatchPos, "strstr and icu give different match positions.");

- int32_t i;

- // int32_t j=0;

- // Try loopcounts around 100000 to some millions, depending on the operation,

- // to get runtimes of at least several seconds.

- for (i=0; i<10000; i++) {

- found = usearch_search(uss.getAlias(), 0, &icuMatchPos, &icuMatchEnd, &status);

- (void)found; // Suppress set but not used warning.

- //TEST_ASSERT_SUCCESS(status);

- //TEST_ASSERT(found);

- // usearch_setOffset(uss.getAlias(), 0, &status);

- // icuMatchPos = usearch_next(uss.getAlias(), &status);

- // The i+j stuff is to confuse the optimizer and get it to actually leave the

- // call to strstr in place.

- //pm = strstr(longishText+j, cPattern);

- //j = (j + i)%5;

- }

- //printf("%ld, %d\n", pm-longishText, j);

-//----------------------------------------------------------------------------------------

-//

-// Random Numbers. Similar to standard lib rand() and srand()

-// Not using library to

-// 1. Get same results on all platforms.

-// 2. Get access to current seed, to more easily reproduce failures.

-//

-//---------------------------------------------------------------------------------------

-static uint32_t m_seed = 1;

-static uint32_t m_rand()

- m_seed = m_seed * 1103515245 + 12345;

- return (uint32_t)(m_seed/65536) % 32768;

-class Monkey

-public:

- virtual void append(UnicodeString &test, UnicodeString &alternate) = 0;

-protected:

- Monkey();

- virtual ~Monkey();

-};

-Monkey::Monkey()

- // ook?

-Monkey::~Monkey()

- // ook?

-class SetMonkey : public Monkey

-public:

- SetMonkey(const USet *theSet);

- ~SetMonkey();

- virtual void append(UnicodeString &test, UnicodeString &alternate);

-private:

- const USet *set;

-};

-SetMonkey::SetMonkey(const USet *theSet)

- : Monkey(), set(theSet)

- // ook?

-SetMonkey::~SetMonkey()

- //ook...

-void SetMonkey::append(UnicodeString &test, UnicodeString &alternate)

- int32_t size = uset_size(set);

- int32_t index = m_rand() % size;

- UChar32 ch = uset_charAt(set, index);

- UnicodeString str(ch);

- test.append(str);

- alternate.append(str); // flip case, or some junk?

-class StringSetMonkey : public Monkey

-public:

- StringSetMonkey(const USet *theSet, UCollator *theCollator, CollData *theCollData);

- ~StringSetMonkey();

- void append(UnicodeString &testCase, UnicodeString &alternate);

-private:

- UnicodeString &generateAlternative(const UnicodeString &testCase, UnicodeString &alternate);

- const USet *set;

- UCollator *coll;

- CollData *collData;

-};

-StringSetMonkey::StringSetMonkey(const USet *theSet, UCollator *theCollator, CollData *theCollData)

-: Monkey(), set(theSet), coll(theCollator), collData(theCollData)

- // ook.

-StringSetMonkey::~StringSetMonkey()

- // ook?

-void StringSetMonkey::append(UnicodeString &testCase, UnicodeString &alternate)

- int32_t itemCount = uset_getItemCount(set), len = 0;

- int32_t index = m_rand() % itemCount;

- UChar32 rangeStart = 0, rangeEnd = 0;

- UChar buffer[16];

- UErrorCode err = U_ZERO_ERROR;

- len = uset_getItem(set, index, &rangeStart, &rangeEnd, buffer, 16, &err);

- if (len == 0) {

- int32_t offset = m_rand() % (rangeEnd - rangeStart + 1);

- UChar32 ch = rangeStart + offset;

- UnicodeString str(ch);

- testCase.append(str);

- generateAlternative(str, alternate);

- } else if (len > 0) {

- // should check that len < 16...

- UnicodeString str(buffer, len);

- testCase.append(str);

- generateAlternative(str, alternate);

- } else {

- // shouldn't happen...

- }

-UnicodeString &StringSetMonkey::generateAlternative(const UnicodeString &testCase, UnicodeString &alternate)

- // find out shortest string for the longest sequence of ces.

- // needs to be refined to use dynamic programming, but will be roughly right

- UErrorCode status = U_ZERO_ERROR;

- CEList ceList(coll, testCase, status);

- UnicodeString alt;

- int32_t offset = 0;

- if (ceList.size() == 0) {

- return alternate.append(testCase);

- }

- while (offset < ceList.size()) {

- int32_t ce = ceList.get(offset);

- const StringList *strings = collData->getStringList(ce);

- if (strings == NULL) {

- return alternate.append(testCase);

- }

- int32_t stringCount = strings->size();

- int32_t tries = 0;

- // find random string that generates the same CEList

- const CEList *ceList2 = NULL;

- const UnicodeString *string = NULL;

- UBool matches = FALSE;

- do {

- int32_t s = m_rand() % stringCount;

- if (tries++ > stringCount) {

- alternate.append(testCase);

- return alternate;

- }

- string = strings->get(s);

- ceList2 = collData->getCEList(string);

- matches = ceList.matchesAt(offset, ceList2);

- if (! matches) {

- collData->freeCEList((CEList *) ceList2);

- }

- } while (! matches);

- alt.append(*string);

- offset += ceList2->size();

- collData->freeCEList(ceList2);

- }

- const CEList altCEs(coll, alt, status);

- if (ceList.matchesAt(0, &altCEs)) {

- return alternate.append(alt);

- }

- return alternate.append(testCase);

-static void generateTestCase(UCollator *coll, Monkey *monkeys[], int32_t monkeyCount, UnicodeString &testCase, UnicodeString &alternate)

- int32_t pieces = (m_rand() % 4) + 1;

- UErrorCode status = U_ZERO_ERROR;

- UBool matches;

- do {

- testCase.remove();

- alternate.remove();

- monkeys[0]->append(testCase, alternate);

- for(int32_t piece = 0; piece < pieces; piece += 1) {

- int32_t monkey = m_rand() % monkeyCount;

- monkeys[monkey]->append(testCase, alternate);

- }

- const CEList ceTest(coll, testCase, status);

- const CEList ceAlt(coll, alternate, status);

- matches = ceTest.matchesAt(0, &ceAlt);

- } while (! matches);

-static UBool simpleSearch(UCollator *coll, const UnicodeString &target, int32_t offset, const UnicodeString &pattern, int32_t &matchStart, int32_t &matchEnd)

- UErrorCode status = U_ZERO_ERROR;

- OrderList targetOrders(coll, target, offset);

- OrderList patternOrders(coll, pattern);

- int32_t targetSize = targetOrders.size() - 1;

- int32_t patternSize = patternOrders.size() - 1;

- UBreakIterator *charBreakIterator = ubrk_open(UBRK_CHARACTER, ucol_getLocaleByType(coll, ULOC_VALID_LOCALE, &status),

- target.getBuffer(), target.length(), &status);

- if (patternSize == 0) {

- // Searching for an empty pattern always fails

- matchStart = matchEnd = -1;

- ubrk_close(charBreakIterator);

- return FALSE;

- }

- matchStart = matchEnd = -1;

- for(int32_t i = 0; i < targetSize; i += 1) {

- if (targetOrders.matchesAt(i, patternOrders)) {

- int32_t start = targetOrders.getLowOffset(i);

- int32_t maxLimit = targetOrders.getLowOffset(i + patternSize);

- int32_t minLimit = targetOrders.getLowOffset(i + patternSize - 1);

- // if the low and high offsets of the first CE in

- // the match are the same, it means that the match

- // starts in the middle of an expansion - all but

- // the first CE of the expansion will have the offset

- // of the following character.

- if (start == targetOrders.getHighOffset(i)) {

- continue;

- }

- // Make sure match starts on a grapheme boundary

- if (! ubrk_isBoundary(charBreakIterator, start)) {

- continue;

- }

- // If the low and high offsets of the CE after the match

- // are the same, it means that the match ends in the middle

- // of an expansion sequence.

- if (maxLimit == targetOrders.getHighOffset(i + patternSize) &&

- targetOrders.getOrder(i + patternSize) != UCOL_NULLORDER) {

- continue;

- }

- int32_t mend = maxLimit;

- // Find the first grapheme break after the character index

- // of the last CE in the match. If it's after character index

- // that's after the last CE in the match, use that index

- // as the end of the match.

- if (minLimit < maxLimit) {

- // When the last CE's low index is same with its high index, the CE is likely

- // a part of expansion. In this case, the index is located just after the

- // character corresponding to the CEs compared above. If the index is right

- // at the break boundary, move the position to the next boundary will result

- // incorrect match length when there are ignorable characters exist between

- // the position and the next character produces CE(s). See ticket#8482.

- if (minLimit == targetOrders.getHighOffset(i + patternSize - 1) && ubrk_isBoundary(charBreakIterator, minLimit)) {

- mend = minLimit;

- } else {

- int32_t nba = ubrk_following(charBreakIterator, minLimit);

- if (nba >= targetOrders.getHighOffset(i + patternSize - 1)) {

- mend = nba;

- }

- if (mend > maxLimit) {

- continue;

- }

- if (! ubrk_isBoundary(charBreakIterator, mend)) {

- continue;

- }

- matchStart = start;

- matchEnd = mend;

- ubrk_close(charBreakIterator);

- return TRUE;

- }

- ubrk_close(charBreakIterator);

- return FALSE;

-#if !UCONFIG_NO_REGULAR_EXPRESSIONS

-static int32_t getIntParam(UnicodeString name, UnicodeString &params, int32_t defaultVal) {

- int32_t val = defaultVal;

- name.append(" *= *(-?\\d+)");

- UErrorCode status = U_ZERO_ERROR;

- RegexMatcher m(name, params, 0, status);

- if (m.find()) {

- // The param exists. Convert the string to an int.

- char valString[100];

- int32_t paramLength = m.end(1, status) - m.start(1, status);

- if (paramLength >= (int32_t)(sizeof(valString)-1)) {

- paramLength = (int32_t)(sizeof(valString)-2);

- }

- params.extract(m.start(1, status), paramLength, valString, sizeof(valString));

- val = uprv_strtol(valString, NULL, 10);

- // Delete this parameter from the params string.

- m.reset();

- params = m.replaceFirst("", status);

- }

- //U_ASSERT(U_SUCCESS(status));

- if (! U_SUCCESS(status)) {

- val = defaultVal;

- }

- return val;

-#endif

-#if !UCONFIG_NO_COLLATION

-int32_t SSearchTest::monkeyTestCase(UCollator *coll, const UnicodeString &testCase, const UnicodeString &pattern, const UnicodeString &altPattern,

- const char *name, const char *strength, uint32_t seed)

- UErrorCode status = U_ZERO_ERROR;

- int32_t actualStart = -1, actualEnd = -1;

- //int32_t expectedStart = prefix.length(), expectedEnd = prefix.length() + altPattern.length();

- int32_t expectedStart = -1, expectedEnd = -1;

- int32_t notFoundCount = 0;

- LocalUStringSearchPointer uss(usearch_openFromCollator(pattern.getBuffer(), pattern.length(),

- testCase.getBuffer(), testCase.length(),

- coll,

- NULL, // the break iterator

- &status));

- // **** TODO: find *all* matches, not just first one ****

- simpleSearch(coll, testCase, 0, pattern, expectedStart, expectedEnd);

- usearch_search(uss.getAlias(), 0, &actualStart, &actualEnd, &status);

- if (expectedStart >= 0 && (actualStart != expectedStart || actualEnd != expectedEnd)) {

- errln("Search for <pattern> in <%s> failed: expected [%d, %d], got [%d, %d]\n"

- " strength=%s seed=%d",

- name, expectedStart, expectedEnd, actualStart, actualEnd, strength, seed);

- }

- if (expectedStart == -1 && actualStart == -1) {

- notFoundCount += 1;

- }

- // **** TODO: find *all* matches, not just first one ****

- simpleSearch(coll, testCase, 0, altPattern, expectedStart, expectedEnd);

- usearch_setPattern(uss.getAlias(), altPattern.getBuffer(), altPattern.length(), &status);

- usearch_search(uss.getAlias(), 0, &actualStart, &actualEnd, &status);

- if (expectedStart >= 0 && (actualStart != expectedStart || actualEnd != expectedEnd)) {

- errln("Search for <alt_pattern> in <%s> failed: expected [%d, %d], got [%d, %d]\n"

- " strength=%s seed=%d",

- name, expectedStart, expectedEnd, actualStart, actualEnd, strength, seed);

- }

- if (expectedStart == -1 && actualStart == -1) {

- notFoundCount += 1;

- }

- return notFoundCount;

-#endif

-void SSearchTest::monkeyTest(char *params)

- // ook!

- UErrorCode status = U_ZERO_ERROR;

- //UCollator *coll = ucol_open(NULL, &status);

- UCollator *coll = ucol_openFromShortString("S1", FALSE, NULL, &status);

- if (U_FAILURE(status)) {

- errcheckln(status, "Failed to create collator in MonkeyTest! - %s", u_errorName(status));

- return;

- }

- CollData *monkeyData = new CollData(coll, status);

- USet *expansions = uset_openEmpty();

- USet *contractions = uset_openEmpty();

- ucol_getContractionsAndExpansions(coll, contractions, expansions, FALSE, &status);

- U_STRING_DECL(letter_pattern, "[[:letter:]-[:ideographic:]-[:hangul:]]", 39);

- U_STRING_INIT(letter_pattern, "[[:letter:]-[:ideographic:]-[:hangul:]]", 39);

- USet *letters = uset_openPattern(letter_pattern, 39, &status);

- SetMonkey letterMonkey(letters);

- StringSetMonkey contractionMonkey(contractions, coll, monkeyData);

- StringSetMonkey expansionMonkey(expansions, coll, monkeyData);

- UnicodeString testCase;

- UnicodeString alternate;

- UnicodeString pattern, altPattern;

- UnicodeString prefix, altPrefix;

- UnicodeString suffix, altSuffix;

- Monkey *monkeys[] = {

- &letterMonkey,

- &contractionMonkey,

- &expansionMonkey,

- &contractionMonkey,

- &expansionMonkey,

- &contractionMonkey,

- &expansionMonkey,

- &contractionMonkey,

- &expansionMonkey};

- int32_t monkeyCount = sizeof(monkeys) / sizeof(monkeys[0]);

- // int32_t nonMatchCount = 0;

- UCollationStrength strengths[] = {UCOL_PRIMARY, UCOL_SECONDARY, UCOL_TERTIARY};

- const char *strengthNames[] = {"primary", "secondary", "tertiary"};

- int32_t strengthCount = sizeof(strengths) / sizeof(strengths[0]);

- int32_t loopCount = quick? 1000 : 10000;

- int32_t firstStrength = 0;

- int32_t lastStrength = strengthCount - 1; //*/ 0;

- if (params != NULL) {

-#if !UCONFIG_NO_REGULAR_EXPRESSIONS

- UnicodeString p(params);

- loopCount = getIntParam("loop", p, loopCount);

- m_seed = getIntParam("seed", p, m_seed);

- RegexMatcher m(" *strength *= *(primary|secondary|tertiary) *", p, 0, status);

- if (m.find()) {

- UnicodeString breakType = m.group(1, status);

- for (int32_t s = 0; s < strengthCount; s += 1) {

- if (breakType == strengthNames[s]) {

- firstStrength = lastStrength = s;

- break;

- }

- m.reset();

- p = m.replaceFirst("", status);

- }

- if (RegexMatcher("\\S", p, 0, status).find()) {

- // Each option is stripped out of the option string as it is processed.

- // All options have been checked. The option string should have been completely emptied..

- char buf[100];

- p.extract(buf, sizeof(buf), NULL, status);

- buf[sizeof(buf)-1] = 0;

- errln("Unrecognized or extra parameter: %s\n", buf);

- return;

- }

-#else

- infoln("SSearchTest built with UCONFIG_NO_REGULAR_EXPRESSIONS: ignoring parameters.");

-#endif

- }

- for(int32_t s = firstStrength; s <= lastStrength; s += 1) {

- int32_t notFoundCount = 0;

- logln("Setting strength to %s.", strengthNames[s]);

- ucol_setStrength(coll, strengths[s]);

- // TODO: try alternate prefix and suffix too?

- // TODO: alternates are only equal at primary strength. Is this OK?

- for(int32_t t = 0; t < loopCount; t += 1) {

- uint32_t seed = m_seed;

- // int32_t nmc = 0;

- generateTestCase(coll, monkeys, monkeyCount, pattern, altPattern);

- generateTestCase(coll, monkeys, monkeyCount, prefix, altPrefix);

- generateTestCase(coll, monkeys, monkeyCount, suffix, altSuffix);

- // pattern

- notFoundCount += monkeyTestCase(coll, pattern, pattern, altPattern, "pattern", strengthNames[s], seed);

- testCase.remove();

- testCase.append(prefix);

- testCase.append(/*alt*/pattern);

- // prefix + pattern

- notFoundCount += monkeyTestCase(coll, testCase, pattern, altPattern, "prefix + pattern", strengthNames[s], seed);

- testCase.append(suffix);

- // prefix + pattern + suffix

- notFoundCount += monkeyTestCase(coll, testCase, pattern, altPattern, "prefix + pattern + suffix", strengthNames[s], seed);

- testCase.remove();

- testCase.append(pattern);

- testCase.append(suffix);

- // pattern + suffix

- notFoundCount += monkeyTestCase(coll, testCase, pattern, altPattern, "pattern + suffix", strengthNames[s], seed);

- }

- logln("For strength %s the not found count is %d.", strengthNames[s], notFoundCount);

- }

- uset_close(contractions);

- uset_close(expansions);

- uset_close(letters);

- delete monkeyData;

- ucol_close(coll);

-#endif

« no previous file with comments | « source/test/intltest/ssearch.h ('k') | source/test/intltest/strcase.cpp » ('j') | no next file with comments »